bio_tools 0.1.3

Install, run, and inspect computational biology and chemistry tools, e.g. AlphaFold, Boltz, RFdiffusion3, and ProteinMPNN
Documentation
{
  "fields": [
    {
      "name": "query_name",
      "label": "Query name",
      "kind": "text",
      "default": "antibody-query",
      "required": false,
      "help": "",
      "options": [],
      "rows": null,
      "minimum": null,
      "maximum": null,
      "step": null,
      "maxlength": null,
      "accept": "",
      "task": ""
    },
    {
      "name": "sequence_type",
      "label": "Sequence type",
      "kind": "select",
      "default": "nucleotide",
      "required": false,
      "help": "",
      "options": [
        {
          "value": "nucleotide",
          "label": "Nucleotide"
        },
        {
          "value": "protein",
          "label": "Protein"
        }
      ],
      "rows": null,
      "minimum": null,
      "maximum": null,
      "step": null,
      "maxlength": null,
      "accept": "",
      "task": ""
    },
    {
      "name": "sequence",
      "label": "Sequence",
      "kind": "textarea",
      "default": "CAGGTGCAGCTGGTGCAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCT",
      "required": true,
      "help": "",
      "options": [],
      "rows": 8,
      "minimum": null,
      "maximum": null,
      "step": null,
      "maxlength": null,
      "accept": "",
      "task": ""
    },
    {
      "name": "organism",
      "label": "Organism",
      "kind": "select",
      "default": "human",
      "required": false,
      "help": "Selects the internal annotation data; match it to the databases below.",
      "options": [
        {
          "value": "human",
          "label": "Human"
        },
        {
          "value": "mouse",
          "label": "Mouse"
        },
        {
          "value": "rat",
          "label": "Rat"
        },
        {
          "value": "rabbit",
          "label": "Rabbit"
        },
        {
          "value": "rhesus_monkey",
          "label": "Rhesus monkey"
        }
      ],
      "rows": null,
      "minimum": null,
      "maximum": null,
      "step": null,
      "maxlength": null,
      "accept": "",
      "task": ""
    },
    {
      "name": "germline_db_v",
      "label": "Germline V database",
      "kind": "select",
      "default": "airr_c_129S1_SvImJ.V",
      "required": false,
      "help": "BLAST databases found under the configured germline root.",
      "options": [
        {
          "value": "airr_c_129S1_SvImJ.V",
          "label": "airr_c_129S1_SvImJ.V"
        },
        {
          "value": "airr_c_AKR_J.V",
          "label": "airr_c_AKR_J.V"
        },
        {
          "value": "airr_c_A_J.V",
          "label": "airr_c_A_J.V"
        },
        {
          "value": "airr_c_BALB_c_ByJ.V",
          "label": "airr_c_BALB_c_ByJ.V"
        },
        {
          "value": "airr_c_C3H_HeJ.V",
          "label": "airr_c_C3H_HeJ.V"
        },
        {
          "value": "airr_c_C57BL_6.V",
          "label": "airr_c_C57BL_6.V"
        },
        {
          "value": "airr_c_C57BL_6J.V",
          "label": "airr_c_C57BL_6J.V"
        },
        {
          "value": "airr_c_CAST_EiJ.V",
          "label": "airr_c_CAST_EiJ.V"
        },
        {
          "value": "airr_c_CBA_J.V",
          "label": "airr_c_CBA_J.V"
        },
        {
          "value": "airr_c_DBA_1J.V",
          "label": "airr_c_DBA_1J.V"
        },
        {
          "value": "airr_c_DBA_2J.V",
          "label": "airr_c_DBA_2J.V"
        },
        {
          "value": "airr_c_LEWES_EiJ.V",
          "label": "airr_c_LEWES_EiJ.V"
        },
        {
          "value": "airr_c_MRL_MpJ.V",
          "label": "airr_c_MRL_MpJ.V"
        },
        {
          "value": "airr_c_MSM_MsJI.V",
          "label": "airr_c_MSM_MsJI.V"
        },
        {
          "value": "airr_c_NOD_ShiLtJ.V",
          "label": "airr_c_NOD_ShiLtJ.V"
        },
        {
          "value": "airr_c_NOR_LtJ.V",
          "label": "airr_c_NOR_LtJ.V"
        },
        {
          "value": "airr_c_NZB_BlNJ.V",
          "label": "airr_c_NZB_BlNJ.V"
        },
        {
          "value": "airr_c_PWD_PhJ.V",
          "label": "airr_c_PWD_PhJ.V"
        },
        {
          "value": "airr_c_SJL_J.V",
          "label": "airr_c_SJL_J.V"
        },
        {
          "value": "airr_c_balbc.V",
          "label": "airr_c_balbc.V"
        },
        {
          "value": "airr_c_human_ig.V",
          "label": "airr_c_human_ig.V"
        },
        {
          "value": "mouse_gl_V",
          "label": "mouse_gl_V"
        },
        {
          "value": "rhesus_monkey_V",
          "label": "rhesus_monkey_V"
        }
      ],
      "rows": null,
      "minimum": null,
      "maximum": null,
      "step": null,
      "maxlength": null,
      "accept": "",
      "task": ""
    },
    {
      "name": "germline_db_d",
      "label": "Germline D database",
      "kind": "select",
      "default": "",
      "required": false,
      "help": "BLAST databases found under the configured germline root.",
      "options": [
        {
          "value": "",
          "label": "None"
        },
        {
          "value": "airr_c_human_igh.D",
          "label": "airr_c_human_igh.D"
        },
        {
          "value": "mouse_gl_D",
          "label": "mouse_gl_D"
        }
      ],
      "rows": null,
      "minimum": null,
      "maximum": null,
      "step": null,
      "maxlength": null,
      "accept": "",
      "task": ""
    },
    {
      "name": "germline_db_j",
      "label": "Germline J database",
      "kind": "select",
      "default": "airr_c_human_ig.J",
      "required": false,
      "help": "BLAST databases found under the configured germline root.",
      "options": [
        {
          "value": "airr_c_human_ig.J",
          "label": "airr_c_human_ig.J"
        },
        {
          "value": "mouse_gl_J",
          "label": "mouse_gl_J"
        },
        {
          "value": "rhesus_monkey_J",
          "label": "rhesus_monkey_J"
        }
      ],
      "rows": null,
      "minimum": null,
      "maximum": null,
      "step": null,
      "maxlength": null,
      "accept": "",
      "task": ""
    },
    {
      "name": "domain_system",
      "label": "Domain system",
      "kind": "select",
      "default": "imgt",
      "required": false,
      "help": "",
      "options": [
        {
          "value": "imgt",
          "label": "IMGT"
        },
        {
          "value": "kabat",
          "label": "Kabat"
        }
      ],
      "rows": null,
      "minimum": null,
      "maximum": null,
      "step": null,
      "maxlength": null,
      "accept": "",
      "task": ""
    },
    {
      "name": "num_alignments",
      "label": "Alignments to report",
      "kind": "number",
      "default": 5,
      "required": false,
      "help": "",
      "options": [],
      "rows": null,
      "minimum": 1.0,
      "maximum": 100.0,
      "step": null,
      "maxlength": null,
      "accept": "",
      "task": ""
    }
  ],
  "tasks": []
}