[](https://crates.io/crates/sassy)
[](https://docs.rs/sassy)
[](https://pypi.org/project/sassy-rs/)
# Sassy: SIMD-accelerated Approximate String Matching
Sassy is a library and tool for searching short strings in texts,
a problem that goes by many names:
- approximate string matching,
- pattern matching,
- fuzzy searching.
The motivating application is searching short (length 20 to 100) DNA sequences
in a human genome or e.g. in a set of reads.
Sassy generally works well for patterns/queries up to length 1000,
and supports both ASCII and DNA.
Highlights:
- Sassy uses bitpacking and SIMD.
Its main novelty is tiling these in the text direction.
- Support for _overhang_ alignments where the pattern extends beyond the text.
- Support for (case-insensitive) ASCII, DNA (`ACGT`), and
[IUPAC](https://www.bioinformatics.org/sms/iupac.html) (=`ACGT+NYR...`) alphabets.
- Rust library (`cargo add sassy`), binary (`cargo install sassy`), Python
bindings (`pip install sassy-rs`), and C bindings (see below).
**The paper** can be found here, and evals are in [evals/](evals/).
The main **limitation** is that currently **AVX2** and **BMI2** are required.
## Usage
### 0. Rust library
A larger example can be found in [`src/lib.rs`](src/lib.rs).
```rust
use sassy::{Searcher, Match, profiles::{Dna}, Strand};
let pattern = b"ATCG";
let text = b"AAAATTGAAA";
let k = 1;
let mut searcher = Searcher::<Dna>::new_fwd();
let matches = searcher.search(pattern, &text, k);
assert_eq!(matches.len(), 1);
assert_eq!(matches[0].text_start, 3);
assert_eq!(matches[0].text_end, 7);
assert_eq!(matches[0].cost, 1);
assert_eq!(matches[0].strand, Strand::Fwd);
assert_eq!(matches[0].cigar.to_string(), "2=X=");
```
### 1. Command-line interface (CLI)
**Build and install** using `cargo`:
```bash
cargo install sassy
```
**Search a pattern** `ATGAGCA` in `text.fasta` with ≤1 edit:
```bash
sassy search --pattern ATGAGCA --alphabet dna -k 1 text.fasta
```
or search all records of a fasta file with `--pattern-fasta <fasta-file>` instead of `--pattern`.
For the alphabets see [supported alphabets](#supported-alphabets)
**CRISPR off-target search** for guides in `guides.txt`:
```bash
sassy crispr --guide guides.txt --k 1 text.fasta
```
Allows `<= k` edits in the sgRNA, and the PAM has to match exactly, unless
`--allow-pam-edits` is given.
### 2. Python bindings
PyPI wheels can be installed with:
```bash
pip install sassy-rs
```
```python
import sassy
pattern = b"ACTG"
text = b"ACGGCTACGCAGCATCATCAGCAT"
searcher = sassy.Searcher("dna") # ascii / dna / iupac
matches = searcher.search(pattern, text, k=1)
for m in matches:
print(m)
```
See [python/README.md](python/README.md) for more details.
### 3. C library
See [c/README.md](c/README.md) for details. Quick example:
```c
#include "sassy.h"
int main() {
const char* pattern = "ACTG";
const char* text = "ACGGCTACGCAGCATCATCAGCAT";
// DNA alphabet, with reverse complement, without overhang.
sassy_SearcherType* searcher = sassy_searcher("dna", true, NAN);
sassy_Match* out_matches = NULL;
size_t n_matches = search(searcher,
pattern, strlen(pattern),
text, strlen(text),
1, // k=1
&out_matches);
sassy_matches_free(out_matches, n_matches);
sassy_searcher_free(searcher);
}
```