sassy 0.1.2

Approximate string matching using SIMD
Documentation

crates.io docs.rs PyPI

Sassy: SIMD-accelerated Approximate String Matching

Sassy is a library and tool for searching short strings in texts, a problem that goes by many names:

  • approximate string matching,
  • pattern matching,
  • fuzzy searching.

The motivating application is searching short (length 20 to 100) DNA sequences in a human genome or e.g. in a set of reads. Sassy generally works well for patterns/queries up to length 1000, and supports both ASCII and DNA.

Highlights:

  • Sassy uses bitpacking and SIMD. Its main novelty is tiling these in the text direction.
  • Support for overhang alignments where the pattern extends beyond the text.
  • Support for (case-insensitive) ASCII, DNA (ACGT), and IUPAC (=ACGT+NYR...) alphabets.
  • Rust library (cargo add sassy), binary (cargo install sassy), Python bindings (pip install sassy-rs), and C bindings (see below).

The paper can be found here, and evals are in evals/.

The main limitation is that currently AVX2 and BMI2 are required.

Usage

0. Rust library

A larger example can be found in src/lib.rs.

use sassy::{Searcher, Match, profiles::{Dna}, Strand};

let pattern = b"ATCG";
let text = b"AAAATTGAAA";
let k = 1;

let mut searcher = Searcher::<Dna>::new_fwd();
let matches = searcher.search(pattern, &text, k);

assert_eq!(matches.len(), 1);

assert_eq!(matches[0].text_start, 3);
assert_eq!(matches[0].text_end, 7);
assert_eq!(matches[0].cost, 1);
assert_eq!(matches[0].strand, Strand::Fwd);
assert_eq!(matches[0].cigar.to_string(), "2=X=");

1. Command-line interface (CLI)

Build and install using cargo:

cargo install sassy

Search a pattern ATGAGCA in text.fasta with ≤1 edit:

sassy search --pattern ATGAGCA --alphabet dna -k 1 text.fasta

or search all records of a fasta file with --pattern-fasta <fasta-file> instead of --pattern.

For the alphabets see supported alphabets

CRISPR off-target search for guides in guides.txt:

sassy crispr --guide guides.txt --k 1  text.fasta

Allows <= k edits in the sgRNA, and the PAM has to match exactly, unless --allow-pam-edits is given.

2. Python bindings

PyPI wheels can be installed with:

pip install sassy-rs 
import sassy

pattern = b"ACTG"
text    = b"ACGGCTACGCAGCATCATCAGCAT"

searcher = sassy.Searcher("dna") # ascii / dna / iupac
matches  = searcher.search(pattern, text, k=1)

for m in matches:
    print(m)

See python/README.md for more details.

3. C library

See c/README.md for details. Quick example:

#include "sassy.h"

int main() {
    const char* pattern = "ACTG";
    const char* text    = "ACGGCTACGCAGCATCATCAGCAT";

    // DNA alphabet, with reverse complement, without overhang.
    sassy_SearcherType* searcher = sassy_searcher("dna", true, NAN);
    sassy_Match* out_matches = NULL;
    size_t n_matches = search(searcher,
                              pattern, strlen(pattern),
                              text, strlen(text),
                              1, // k=1
                              &out_matches);

    sassy_matches_free(out_matches, n_matches);
    sassy_searcher_free(searcher);
}