A rust FFI library for minimap2. In development! Feedback appreciated!
Structure
minimap2-sys is the library of the raw FFI bindings to minimap2. minimap2 is the most rusty version.
How to use
Requirements
Clang is required to build (probably....)
= "1.1.6"
Tested with rustc 1.64.0 and nightly. So probably a good idea to upgrade before running. But let me know if you run into pain points with older versions and will try to fix!
Usage
Create an Aligner
let mut aligner = Aligner
.with_cigar
.with_index
.expect;
Align a sequence:
let seq: = b"ACTGACTCACATCGACTACGACTACTAGACACTAGACTATCGACTACTGACATCGA";
let alignment = aligner
.map
.expect;
Presets
All minimap2 presets should be available (see functions section):
let aligner = map_ont;
let aligner = asm20;
Customization
MapOpts and IdxOpts can be customized with Rust's struct pattern, as well as applying mapping settings. Inspired by bevy.
Aligner
Working Example
There is a binary called "fakeminimap2" that I am using to test for memory leaks. You can follow the source code for an example. It also shows some helper functions for identifying compression types and FASTA vs FASTQ files. I used my own parsers as they are well fuzzed, but open to removing them or putting them behind a feature wall.
Alignment functions return a Mapping struct. The Alignment struct is only returned when the Aligner is created using .with_cigar().
A very simple example would be:
let mut file = open;
let mut reader = new;
let mut fasta = from_buffer
for seq in reader
There is a map_file function that works on an entire file, but it is not-lazy and thus not suitable for large files. It may be removed in the future or moved to a separate lib.
let mappings: = aligner.map_file;
Multithreading
Untested, however the thread_local buffer is already set, so theoretically it could work. I may or may not implement it in here, torn between a hold-your-hand library and a lightweight library for those who want to use their own solutions. This may get split into two separate libraries for that very reason (following the zstd concept).
So far multithreading only works for building the index and not for mapping.
Want feedback
- Many fields are i32 / i8 to mimic the C environment, but would it make more sense to convert to u32 / u8 / usize?
- Let me know pain points
Presets currently look like this:
Aligner
or:
Aligner
or:
Aligner
The second pollutes the namespace less, but the first looks less redundant. Open to opinions.
Pain Points
Probably not freeing C memory somewhere.... Not sure yet, if so it's just leaking a little...
Next things todo
- Print other tags so we can have an entire PAF format
- Compile with SSE2 / SSE4.1 / SIMDe (auto-detect, but also make with features)
- Multi-thread guide (tokio async threads or use crossbeam queue and traditional threads?)
- Maybe should be split into 2 more libraries, minimap2-safe (lower but safe level) and minimap2 (high-level api) like zstd? - Then people can implement threading as they like or just fall back to a known-decent implementation?
- Iterator interface for map_file
- MORE TESTS
Citation
You should cite the minimap2 papers if you use this in your work. If you use this extensively, let me know and I'll add a way to cite this project as well with version (Zenodo, probably).
Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics, 34:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
and/or:
Li, H. (2021). New strategies to improve minimap2 alignment accuracy. Bioinformatics, 37:4572-4574. [doi:10.1093/bioinformatics/btab705][doi2]
Changelog
0.1.7
- use libc instead of std:ffi::c_int as well
0.1.6
- Support slightly older versions of rustc by using libc:: rather than std::ffi for c_char (Thanks dwpeng!)
- Use fffx module for fasta/q parsing
