pub struct Aligner<S: BuilderState> {
pub idxopt: IdxOpt,
pub mapopt: MapOpt,
pub threads: usize,
pub idx: Option<Arc<MmIdx>>,
pub idx_parts: Vec<Arc<MmIdx>>,
pub idx_reader: Option<Arc<mm_idx_reader_t>>,
pub cigar_clipping: bool,
/* private fields */
}Expand description
Aligner struct, mimicking minimap2’s python interface
Aligner::builder();Fields§
§idxopt: IdxOptIndex options passed to minimap2 (mm_idxopt_t)
mapopt: MapOptMapping options passed to minimap2 (mm_mapopt_t)
threads: usizeNumber of threads to create the index with
idx: Option<Arc<MmIdx>>Index created by minimap2 For multi-part indexes (large reference genomes), this contains all parts
idx_parts: Vec<Arc<MmIdx>>Index parts for multi-part indexes (large reference genomes) When a reference exceeds batch_size, minimap2 splits it into multiple parts. Each part is processed independently during mapping.
idx_reader: Option<Arc<mm_idx_reader_t>>Index reader created by minimap2
cigar_clipping: boolWhether to add soft clipping to CIGAR result
Implementations§
Source§impl Aligner<()>
impl Aligner<()>
Sourcepub fn builder() -> Aligner<Unset>
pub fn builder() -> Aligner<Unset>
Create a new aligner with default options
Examples found in repository?
32fn map(
33 target_file: impl AsRef<Path>,
34 query_file: impl AsRef<Path>,
35 threads: usize,
36) -> Result<(), Box<dyn Error>> {
37 // Set the number of threads to use
38 rayon::ThreadPoolBuilder::new()
39 .num_threads(threads)
40 .build_global()
41 .expect("Unable to set number of threads");
42
43 println!("Creating index");
44
45 // Aligner gets created using the build pattern.
46 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
47 let aligner = Aligner::builder()
48 .map_ont()
49 .with_cigar()
50 .with_index_threads(threads) // Minimap2 uses it's own thread pool for index building
51 .with_index(target_file, None)
52 .expect("Unable to build index");
53
54 println!("Index created");
55
56 // Read in the query file
57 let mut reader = parse_fastx_file(query_file)?;
58
59 let mut queries: Vec<(Vec<u8>, Vec<u8>)> = Vec::new();
60 while let Some(record) = reader.next() {
61 let record = record.expect("Error reading record");
62 queries.push((record.id().to_vec(), record.seq().to_vec()));
63 }
64
65 // Map the queries
66 let results: Vec<Vec<Mapping>> = queries
67 .par_iter()
68 .map(|(id, seq)| {
69 aligner
70 .map(&seq, false, false, None, None, Some(&id))
71 .expect("Error mapping")
72 })
73 .collect();
74
75 // Count total number of alignments
76 let total_alignments: usize = results.iter().map(|x| x.len()).sum();
77 println!("Iteration complete, total alignments {}", total_alignments);
78
79 Ok(())
80}More examples
50fn map(
51 target_file: impl AsRef<Path>,
52 query_file: impl AsRef<Path>,
53 threads: usize,
54) -> Result<(), Box<dyn Error>> {
55 // Aligner gets created using the build pattern.
56 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
57 println!("Creating index");
58 let aligner = Aligner::builder()
59 .map_ont()
60 .with_cigar()
61 .with_index_threads(threads)
62 .with_index(target_file, None)
63 .expect("Unable to build index");
64
65 println!("Index created");
66
67 // Create a queue for work and for results
68 let work_queue = Arc::new(ArrayQueue::<WorkQueue<WorkUnit>>::new(1024));
69 let results_queue = Arc::new(ArrayQueue::<WorkQueue<WorkResult>>::new(1024));
70
71 // I use a shutdown flag
72 let shutdown = std::sync::Arc::new(std::sync::atomic::AtomicBool::new(false));
73
74 // Store join handles, it's just good practice to clean up threads
75 let mut jh = Vec::new();
76
77 let aligner = Arc::new(aligner);
78
79 // Spin up the threads
80 for _ in 0..threads {
81 // Clone everything we will need...
82 let work_queue = Arc::clone(&work_queue);
83 let results_queue = Arc::clone(&results_queue);
84 let shutdown = Arc::clone(&shutdown);
85 let aligner = Arc::clone(&aligner);
86
87 let handle =
88 std::thread::spawn(move || worker(work_queue, results_queue, shutdown, aligner));
89
90 jh.push(handle);
91 }
92
93 // Let's split this into another thread
94
95 {
96 let work_queue = Arc::clone(&work_queue);
97 let shutdown = Arc::clone(&shutdown);
98 let query_file = query_file.as_ref().to_path_buf();
99
100 let handle = std::thread::spawn(move || {
101 // Now that the threads are running, read the input file and push the work to the queue
102 let mut reader: Box<dyn FastxReader> = parse_fastx_file(query_file)
103 .unwrap_or_else(|_| panic!("Can't find query FASTA file"));
104
105 // I just do this in the main thread, but you can split threads
106 let backoff = crossbeam::utils::Backoff::new();
107 while let Some(Ok(record)) = reader.next() {
108 let mut work = WorkQueue::Work((record.id().to_vec(), record.seq().to_vec()));
109 while let Err(work_packet) = work_queue.push(work) {
110 work = work_packet; // Simple way to maintain ownership
111 // If we have an error, it's 99% because the queue is full
112 backoff.snooze();
113 }
114 }
115
116 // Set the shutdown flag
117 shutdown.store(true, std::sync::atomic::Ordering::Relaxed);
118 });
119
120 jh.push(handle);
121 }
122
123 let mut num_alignments = 0;
124
125 let backoff = crossbeam::utils::Backoff::new();
126 loop {
127 match results_queue.pop() {
128 // This is where we processs mapping results as they come in...
129 Some(WorkQueue::Result((record, alignments))) => {
130 num_alignments += alignments.len();
131 }
132 Some(_) => unimplemented!("Unexpected result type"),
133 None => {
134 backoff.snooze();
135
136 // If all join handles are finished, we can break
137 if jh.iter().all(|h| h.is_finished()) {
138 break;
139 }
140 if backoff.is_completed() {
141 backoff.reset();
142 std::thread::sleep(Duration::from_millis(3));
143 }
144 }
145 }
146 }
147
148 // Join all the threads
149 for handle in jh {
150 handle.join().expect("Unable to join thread");
151 }
152
153 println!("Total alignments: {}", num_alignments);
154
155 Ok(())
156}Source§impl Aligner<Unset>
impl Aligner<Unset>
Sourcepub fn lrhq(self) -> Aligner<PresetSet>
pub fn lrhq(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to lr:hq.
Presets should be called before any other options are set, as they change multiple options at once.
Sourcepub fn splice(self) -> Aligner<PresetSet>
pub fn splice(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to splice
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().splice();Sourcepub fn splice_hq(self) -> Aligner<PresetSet>
pub fn splice_hq(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to splice:hq
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().splice_hq();Sourcepub fn splice_sr(self) -> Aligner<PresetSet>
pub fn splice_sr(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to splice:sr
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().splice_sr();Sourcepub fn asm(self) -> Aligner<PresetSet>
pub fn asm(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to Asm
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().asm();Sourcepub fn asm5(self) -> Aligner<PresetSet>
pub fn asm5(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to Asm5
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().asm5();Sourcepub fn asm10(self) -> Aligner<PresetSet>
pub fn asm10(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to Asm10
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().asm10();Sourcepub fn asm20(self) -> Aligner<PresetSet>
pub fn asm20(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to Asm20
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().asm20();Sourcepub fn sr(self) -> Aligner<PresetSet>
pub fn sr(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to sr
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().sr();Sourcepub fn map_pb(self) -> Aligner<PresetSet>
pub fn map_pb(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to MapPb
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().map_pb();Sourcepub fn map_hifi(self) -> Aligner<PresetSet>
pub fn map_hifi(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to MapHifi
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().map_hifi();Sourcepub fn map_ont(self) -> Aligner<PresetSet>
pub fn map_ont(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to MapOnt.
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().map_ont();Examples found in repository?
32fn map(
33 target_file: impl AsRef<Path>,
34 query_file: impl AsRef<Path>,
35 threads: usize,
36) -> Result<(), Box<dyn Error>> {
37 // Set the number of threads to use
38 rayon::ThreadPoolBuilder::new()
39 .num_threads(threads)
40 .build_global()
41 .expect("Unable to set number of threads");
42
43 println!("Creating index");
44
45 // Aligner gets created using the build pattern.
46 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
47 let aligner = Aligner::builder()
48 .map_ont()
49 .with_cigar()
50 .with_index_threads(threads) // Minimap2 uses it's own thread pool for index building
51 .with_index(target_file, None)
52 .expect("Unable to build index");
53
54 println!("Index created");
55
56 // Read in the query file
57 let mut reader = parse_fastx_file(query_file)?;
58
59 let mut queries: Vec<(Vec<u8>, Vec<u8>)> = Vec::new();
60 while let Some(record) = reader.next() {
61 let record = record.expect("Error reading record");
62 queries.push((record.id().to_vec(), record.seq().to_vec()));
63 }
64
65 // Map the queries
66 let results: Vec<Vec<Mapping>> = queries
67 .par_iter()
68 .map(|(id, seq)| {
69 aligner
70 .map(&seq, false, false, None, None, Some(&id))
71 .expect("Error mapping")
72 })
73 .collect();
74
75 // Count total number of alignments
76 let total_alignments: usize = results.iter().map(|x| x.len()).sum();
77 println!("Iteration complete, total alignments {}", total_alignments);
78
79 Ok(())
80}More examples
50fn map(
51 target_file: impl AsRef<Path>,
52 query_file: impl AsRef<Path>,
53 threads: usize,
54) -> Result<(), Box<dyn Error>> {
55 // Aligner gets created using the build pattern.
56 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
57 println!("Creating index");
58 let aligner = Aligner::builder()
59 .map_ont()
60 .with_cigar()
61 .with_index_threads(threads)
62 .with_index(target_file, None)
63 .expect("Unable to build index");
64
65 println!("Index created");
66
67 // Create a queue for work and for results
68 let work_queue = Arc::new(ArrayQueue::<WorkQueue<WorkUnit>>::new(1024));
69 let results_queue = Arc::new(ArrayQueue::<WorkQueue<WorkResult>>::new(1024));
70
71 // I use a shutdown flag
72 let shutdown = std::sync::Arc::new(std::sync::atomic::AtomicBool::new(false));
73
74 // Store join handles, it's just good practice to clean up threads
75 let mut jh = Vec::new();
76
77 let aligner = Arc::new(aligner);
78
79 // Spin up the threads
80 for _ in 0..threads {
81 // Clone everything we will need...
82 let work_queue = Arc::clone(&work_queue);
83 let results_queue = Arc::clone(&results_queue);
84 let shutdown = Arc::clone(&shutdown);
85 let aligner = Arc::clone(&aligner);
86
87 let handle =
88 std::thread::spawn(move || worker(work_queue, results_queue, shutdown, aligner));
89
90 jh.push(handle);
91 }
92
93 // Let's split this into another thread
94
95 {
96 let work_queue = Arc::clone(&work_queue);
97 let shutdown = Arc::clone(&shutdown);
98 let query_file = query_file.as_ref().to_path_buf();
99
100 let handle = std::thread::spawn(move || {
101 // Now that the threads are running, read the input file and push the work to the queue
102 let mut reader: Box<dyn FastxReader> = parse_fastx_file(query_file)
103 .unwrap_or_else(|_| panic!("Can't find query FASTA file"));
104
105 // I just do this in the main thread, but you can split threads
106 let backoff = crossbeam::utils::Backoff::new();
107 while let Some(Ok(record)) = reader.next() {
108 let mut work = WorkQueue::Work((record.id().to_vec(), record.seq().to_vec()));
109 while let Err(work_packet) = work_queue.push(work) {
110 work = work_packet; // Simple way to maintain ownership
111 // If we have an error, it's 99% because the queue is full
112 backoff.snooze();
113 }
114 }
115
116 // Set the shutdown flag
117 shutdown.store(true, std::sync::atomic::Ordering::Relaxed);
118 });
119
120 jh.push(handle);
121 }
122
123 let mut num_alignments = 0;
124
125 let backoff = crossbeam::utils::Backoff::new();
126 loop {
127 match results_queue.pop() {
128 // This is where we processs mapping results as they come in...
129 Some(WorkQueue::Result((record, alignments))) => {
130 num_alignments += alignments.len();
131 }
132 Some(_) => unimplemented!("Unexpected result type"),
133 None => {
134 backoff.snooze();
135
136 // If all join handles are finished, we can break
137 if jh.iter().all(|h| h.is_finished()) {
138 break;
139 }
140 if backoff.is_completed() {
141 backoff.reset();
142 std::thread::sleep(Duration::from_millis(3));
143 }
144 }
145 }
146 }
147
148 // Join all the threads
149 for handle in jh {
150 handle.join().expect("Unable to join thread");
151 }
152
153 println!("Total alignments: {}", num_alignments);
154
155 Ok(())
156}Sourcepub fn ava_pb(self) -> Aligner<PresetSet>
pub fn ava_pb(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to AvaPb
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().ava_pb();Sourcepub fn ava_ont(self) -> Aligner<PresetSet>
pub fn ava_ont(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to AvaOnt.
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().ava_ont();Sourcepub fn short(self) -> Aligner<PresetSet>
pub fn short(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to Short
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().short();Sourcepub fn map10k(self) -> Aligner<PresetSet>
pub fn map10k(self) -> Aligner<PresetSet>
Ergonomic function for Aligner. Sets the minimap2 preset to Map10k
Presets should be called before any other options are set, as they change multiple options at once.
Aligner::builder().map10k();Source§impl<S> Aligner<S>where
S: BuilderState + AcceptsParams,
impl<S> Aligner<S>where
S: BuilderState + AcceptsParams,
Sourcepub fn with_cigar(self) -> Self
pub fn with_cigar(self) -> Self
Set Alignment mode / cigar mode in minimap2
Aligner::builder().map_ont().with_cigar();Examples found in repository?
32fn map(
33 target_file: impl AsRef<Path>,
34 query_file: impl AsRef<Path>,
35 threads: usize,
36) -> Result<(), Box<dyn Error>> {
37 // Set the number of threads to use
38 rayon::ThreadPoolBuilder::new()
39 .num_threads(threads)
40 .build_global()
41 .expect("Unable to set number of threads");
42
43 println!("Creating index");
44
45 // Aligner gets created using the build pattern.
46 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
47 let aligner = Aligner::builder()
48 .map_ont()
49 .with_cigar()
50 .with_index_threads(threads) // Minimap2 uses it's own thread pool for index building
51 .with_index(target_file, None)
52 .expect("Unable to build index");
53
54 println!("Index created");
55
56 // Read in the query file
57 let mut reader = parse_fastx_file(query_file)?;
58
59 let mut queries: Vec<(Vec<u8>, Vec<u8>)> = Vec::new();
60 while let Some(record) = reader.next() {
61 let record = record.expect("Error reading record");
62 queries.push((record.id().to_vec(), record.seq().to_vec()));
63 }
64
65 // Map the queries
66 let results: Vec<Vec<Mapping>> = queries
67 .par_iter()
68 .map(|(id, seq)| {
69 aligner
70 .map(&seq, false, false, None, None, Some(&id))
71 .expect("Error mapping")
72 })
73 .collect();
74
75 // Count total number of alignments
76 let total_alignments: usize = results.iter().map(|x| x.len()).sum();
77 println!("Iteration complete, total alignments {}", total_alignments);
78
79 Ok(())
80}More examples
50fn map(
51 target_file: impl AsRef<Path>,
52 query_file: impl AsRef<Path>,
53 threads: usize,
54) -> Result<(), Box<dyn Error>> {
55 // Aligner gets created using the build pattern.
56 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
57 println!("Creating index");
58 let aligner = Aligner::builder()
59 .map_ont()
60 .with_cigar()
61 .with_index_threads(threads)
62 .with_index(target_file, None)
63 .expect("Unable to build index");
64
65 println!("Index created");
66
67 // Create a queue for work and for results
68 let work_queue = Arc::new(ArrayQueue::<WorkQueue<WorkUnit>>::new(1024));
69 let results_queue = Arc::new(ArrayQueue::<WorkQueue<WorkResult>>::new(1024));
70
71 // I use a shutdown flag
72 let shutdown = std::sync::Arc::new(std::sync::atomic::AtomicBool::new(false));
73
74 // Store join handles, it's just good practice to clean up threads
75 let mut jh = Vec::new();
76
77 let aligner = Arc::new(aligner);
78
79 // Spin up the threads
80 for _ in 0..threads {
81 // Clone everything we will need...
82 let work_queue = Arc::clone(&work_queue);
83 let results_queue = Arc::clone(&results_queue);
84 let shutdown = Arc::clone(&shutdown);
85 let aligner = Arc::clone(&aligner);
86
87 let handle =
88 std::thread::spawn(move || worker(work_queue, results_queue, shutdown, aligner));
89
90 jh.push(handle);
91 }
92
93 // Let's split this into another thread
94
95 {
96 let work_queue = Arc::clone(&work_queue);
97 let shutdown = Arc::clone(&shutdown);
98 let query_file = query_file.as_ref().to_path_buf();
99
100 let handle = std::thread::spawn(move || {
101 // Now that the threads are running, read the input file and push the work to the queue
102 let mut reader: Box<dyn FastxReader> = parse_fastx_file(query_file)
103 .unwrap_or_else(|_| panic!("Can't find query FASTA file"));
104
105 // I just do this in the main thread, but you can split threads
106 let backoff = crossbeam::utils::Backoff::new();
107 while let Some(Ok(record)) = reader.next() {
108 let mut work = WorkQueue::Work((record.id().to_vec(), record.seq().to_vec()));
109 while let Err(work_packet) = work_queue.push(work) {
110 work = work_packet; // Simple way to maintain ownership
111 // If we have an error, it's 99% because the queue is full
112 backoff.snooze();
113 }
114 }
115
116 // Set the shutdown flag
117 shutdown.store(true, std::sync::atomic::Ordering::Relaxed);
118 });
119
120 jh.push(handle);
121 }
122
123 let mut num_alignments = 0;
124
125 let backoff = crossbeam::utils::Backoff::new();
126 loop {
127 match results_queue.pop() {
128 // This is where we processs mapping results as they come in...
129 Some(WorkQueue::Result((record, alignments))) => {
130 num_alignments += alignments.len();
131 }
132 Some(_) => unimplemented!("Unexpected result type"),
133 None => {
134 backoff.snooze();
135
136 // If all join handles are finished, we can break
137 if jh.iter().all(|h| h.is_finished()) {
138 break;
139 }
140 if backoff.is_completed() {
141 backoff.reset();
142 std::thread::sleep(Duration::from_millis(3));
143 }
144 }
145 }
146 }
147
148 // Join all the threads
149 for handle in jh {
150 handle.join().expect("Unable to join thread");
151 }
152
153 println!("Total alignments: {}", num_alignments);
154
155 Ok(())
156}pub fn with_cigar_clipping(self) -> Self
pub fn with_sam_out(self) -> Self
pub fn with_sam_hit_only(self) -> Self
Sourcepub fn with_gap_open_penalty(
self,
penalty: i32,
penalty_long: Option<i32>,
) -> Self
pub fn with_gap_open_penalty( self, penalty: i32, penalty_long: Option<i32>, ) -> Self
Sets the gap open penalty for minimap2.
minimap2 -O 4 sets both the short and long gap open penalty to 4. minimap2 code
To set the long gap open penalty, simply provide a value for penalty_long.
Sourcepub fn with_index_threads(self, threads: usize) -> Self
pub fn with_index_threads(self, threads: usize) -> Self
Sets the number of threads minimap2 will use for building the index
Aligner::builder().with_index_threads(10);Set the number of threads (prefer to use the struct config)
Examples found in repository?
32fn map(
33 target_file: impl AsRef<Path>,
34 query_file: impl AsRef<Path>,
35 threads: usize,
36) -> Result<(), Box<dyn Error>> {
37 // Set the number of threads to use
38 rayon::ThreadPoolBuilder::new()
39 .num_threads(threads)
40 .build_global()
41 .expect("Unable to set number of threads");
42
43 println!("Creating index");
44
45 // Aligner gets created using the build pattern.
46 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
47 let aligner = Aligner::builder()
48 .map_ont()
49 .with_cigar()
50 .with_index_threads(threads) // Minimap2 uses it's own thread pool for index building
51 .with_index(target_file, None)
52 .expect("Unable to build index");
53
54 println!("Index created");
55
56 // Read in the query file
57 let mut reader = parse_fastx_file(query_file)?;
58
59 let mut queries: Vec<(Vec<u8>, Vec<u8>)> = Vec::new();
60 while let Some(record) = reader.next() {
61 let record = record.expect("Error reading record");
62 queries.push((record.id().to_vec(), record.seq().to_vec()));
63 }
64
65 // Map the queries
66 let results: Vec<Vec<Mapping>> = queries
67 .par_iter()
68 .map(|(id, seq)| {
69 aligner
70 .map(&seq, false, false, None, None, Some(&id))
71 .expect("Error mapping")
72 })
73 .collect();
74
75 // Count total number of alignments
76 let total_alignments: usize = results.iter().map(|x| x.len()).sum();
77 println!("Iteration complete, total alignments {}", total_alignments);
78
79 Ok(())
80}More examples
50fn map(
51 target_file: impl AsRef<Path>,
52 query_file: impl AsRef<Path>,
53 threads: usize,
54) -> Result<(), Box<dyn Error>> {
55 // Aligner gets created using the build pattern.
56 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
57 println!("Creating index");
58 let aligner = Aligner::builder()
59 .map_ont()
60 .with_cigar()
61 .with_index_threads(threads)
62 .with_index(target_file, None)
63 .expect("Unable to build index");
64
65 println!("Index created");
66
67 // Create a queue for work and for results
68 let work_queue = Arc::new(ArrayQueue::<WorkQueue<WorkUnit>>::new(1024));
69 let results_queue = Arc::new(ArrayQueue::<WorkQueue<WorkResult>>::new(1024));
70
71 // I use a shutdown flag
72 let shutdown = std::sync::Arc::new(std::sync::atomic::AtomicBool::new(false));
73
74 // Store join handles, it's just good practice to clean up threads
75 let mut jh = Vec::new();
76
77 let aligner = Arc::new(aligner);
78
79 // Spin up the threads
80 for _ in 0..threads {
81 // Clone everything we will need...
82 let work_queue = Arc::clone(&work_queue);
83 let results_queue = Arc::clone(&results_queue);
84 let shutdown = Arc::clone(&shutdown);
85 let aligner = Arc::clone(&aligner);
86
87 let handle =
88 std::thread::spawn(move || worker(work_queue, results_queue, shutdown, aligner));
89
90 jh.push(handle);
91 }
92
93 // Let's split this into another thread
94
95 {
96 let work_queue = Arc::clone(&work_queue);
97 let shutdown = Arc::clone(&shutdown);
98 let query_file = query_file.as_ref().to_path_buf();
99
100 let handle = std::thread::spawn(move || {
101 // Now that the threads are running, read the input file and push the work to the queue
102 let mut reader: Box<dyn FastxReader> = parse_fastx_file(query_file)
103 .unwrap_or_else(|_| panic!("Can't find query FASTA file"));
104
105 // I just do this in the main thread, but you can split threads
106 let backoff = crossbeam::utils::Backoff::new();
107 while let Some(Ok(record)) = reader.next() {
108 let mut work = WorkQueue::Work((record.id().to_vec(), record.seq().to_vec()));
109 while let Err(work_packet) = work_queue.push(work) {
110 work = work_packet; // Simple way to maintain ownership
111 // If we have an error, it's 99% because the queue is full
112 backoff.snooze();
113 }
114 }
115
116 // Set the shutdown flag
117 shutdown.store(true, std::sync::atomic::Ordering::Relaxed);
118 });
119
120 jh.push(handle);
121 }
122
123 let mut num_alignments = 0;
124
125 let backoff = crossbeam::utils::Backoff::new();
126 loop {
127 match results_queue.pop() {
128 // This is where we processs mapping results as they come in...
129 Some(WorkQueue::Result((record, alignments))) => {
130 num_alignments += alignments.len();
131 }
132 Some(_) => unimplemented!("Unexpected result type"),
133 None => {
134 backoff.snooze();
135
136 // If all join handles are finished, we can break
137 if jh.iter().all(|h| h.is_finished()) {
138 break;
139 }
140 if backoff.is_completed() {
141 backoff.reset();
142 std::thread::sleep(Duration::from_millis(3));
143 }
144 }
145 }
146 }
147
148 // Join all the threads
149 for handle in jh {
150 handle.join().expect("Unable to join thread");
151 }
152
153 println!("Total alignments: {}", num_alignments);
154
155 Ok(())
156}pub fn with_threads(self, threads: usize) -> Self
with_index_threads insteadSourcepub fn check_opts(&self) -> Result<(), &'static str>
pub fn check_opts(&self) -> Result<(), &'static str>
Check if the options are valid - Maps to mm_check_opt in minimap2
Sourcepub fn with_index<P>(
self,
path: P,
output: Option<&str>,
) -> Result<Aligner<Built>, &'static str>
pub fn with_index<P>( self, path: P, output: Option<&str>, ) -> Result<Aligner<Built>, &'static str>
Set index parameters for minimap2 using builder pattern Creates the index as well with the given number of threads (set at struct creation). You must set the number of threads before calling this function.
Parameters: path: Location of pre-built index or FASTA/FASTQ file (may be gzipped or plaintext) Output: Option (None) or a filename
Returns the aligner with the index set
// Do not save the index file
Aligner::builder().map_ont().with_index("test_data/test_data.fasta", None);
// Save the index file as my_index.mmi
Aligner::builder().map_ont().with_index("test_data/test_data.fasta", Some("my_index.mmi"));
// Use the previously built index
Aligner::builder().map_ont().with_index("my_index.mmi", None);Examples found in repository?
32fn map(
33 target_file: impl AsRef<Path>,
34 query_file: impl AsRef<Path>,
35 threads: usize,
36) -> Result<(), Box<dyn Error>> {
37 // Set the number of threads to use
38 rayon::ThreadPoolBuilder::new()
39 .num_threads(threads)
40 .build_global()
41 .expect("Unable to set number of threads");
42
43 println!("Creating index");
44
45 // Aligner gets created using the build pattern.
46 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
47 let aligner = Aligner::builder()
48 .map_ont()
49 .with_cigar()
50 .with_index_threads(threads) // Minimap2 uses it's own thread pool for index building
51 .with_index(target_file, None)
52 .expect("Unable to build index");
53
54 println!("Index created");
55
56 // Read in the query file
57 let mut reader = parse_fastx_file(query_file)?;
58
59 let mut queries: Vec<(Vec<u8>, Vec<u8>)> = Vec::new();
60 while let Some(record) = reader.next() {
61 let record = record.expect("Error reading record");
62 queries.push((record.id().to_vec(), record.seq().to_vec()));
63 }
64
65 // Map the queries
66 let results: Vec<Vec<Mapping>> = queries
67 .par_iter()
68 .map(|(id, seq)| {
69 aligner
70 .map(&seq, false, false, None, None, Some(&id))
71 .expect("Error mapping")
72 })
73 .collect();
74
75 // Count total number of alignments
76 let total_alignments: usize = results.iter().map(|x| x.len()).sum();
77 println!("Iteration complete, total alignments {}", total_alignments);
78
79 Ok(())
80}More examples
50fn map(
51 target_file: impl AsRef<Path>,
52 query_file: impl AsRef<Path>,
53 threads: usize,
54) -> Result<(), Box<dyn Error>> {
55 // Aligner gets created using the build pattern.
56 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
57 println!("Creating index");
58 let aligner = Aligner::builder()
59 .map_ont()
60 .with_cigar()
61 .with_index_threads(threads)
62 .with_index(target_file, None)
63 .expect("Unable to build index");
64
65 println!("Index created");
66
67 // Create a queue for work and for results
68 let work_queue = Arc::new(ArrayQueue::<WorkQueue<WorkUnit>>::new(1024));
69 let results_queue = Arc::new(ArrayQueue::<WorkQueue<WorkResult>>::new(1024));
70
71 // I use a shutdown flag
72 let shutdown = std::sync::Arc::new(std::sync::atomic::AtomicBool::new(false));
73
74 // Store join handles, it's just good practice to clean up threads
75 let mut jh = Vec::new();
76
77 let aligner = Arc::new(aligner);
78
79 // Spin up the threads
80 for _ in 0..threads {
81 // Clone everything we will need...
82 let work_queue = Arc::clone(&work_queue);
83 let results_queue = Arc::clone(&results_queue);
84 let shutdown = Arc::clone(&shutdown);
85 let aligner = Arc::clone(&aligner);
86
87 let handle =
88 std::thread::spawn(move || worker(work_queue, results_queue, shutdown, aligner));
89
90 jh.push(handle);
91 }
92
93 // Let's split this into another thread
94
95 {
96 let work_queue = Arc::clone(&work_queue);
97 let shutdown = Arc::clone(&shutdown);
98 let query_file = query_file.as_ref().to_path_buf();
99
100 let handle = std::thread::spawn(move || {
101 // Now that the threads are running, read the input file and push the work to the queue
102 let mut reader: Box<dyn FastxReader> = parse_fastx_file(query_file)
103 .unwrap_or_else(|_| panic!("Can't find query FASTA file"));
104
105 // I just do this in the main thread, but you can split threads
106 let backoff = crossbeam::utils::Backoff::new();
107 while let Some(Ok(record)) = reader.next() {
108 let mut work = WorkQueue::Work((record.id().to_vec(), record.seq().to_vec()));
109 while let Err(work_packet) = work_queue.push(work) {
110 work = work_packet; // Simple way to maintain ownership
111 // If we have an error, it's 99% because the queue is full
112 backoff.snooze();
113 }
114 }
115
116 // Set the shutdown flag
117 shutdown.store(true, std::sync::atomic::Ordering::Relaxed);
118 });
119
120 jh.push(handle);
121 }
122
123 let mut num_alignments = 0;
124
125 let backoff = crossbeam::utils::Backoff::new();
126 loop {
127 match results_queue.pop() {
128 // This is where we processs mapping results as they come in...
129 Some(WorkQueue::Result((record, alignments))) => {
130 num_alignments += alignments.len();
131 }
132 Some(_) => unimplemented!("Unexpected result type"),
133 None => {
134 backoff.snooze();
135
136 // If all join handles are finished, we can break
137 if jh.iter().all(|h| h.is_finished()) {
138 break;
139 }
140 if backoff.is_completed() {
141 backoff.reset();
142 std::thread::sleep(Duration::from_millis(3));
143 }
144 }
145 }
146 }
147
148 // Join all the threads
149 for handle in jh {
150 handle.join().expect("Unable to join thread");
151 }
152
153 println!("Total alignments: {}", num_alignments);
154
155 Ok(())
156}Sourcepub fn set_index<P>(
self,
path: P,
output: Option<&str>,
) -> Result<Aligner<Built>, &'static str>
pub fn set_index<P>( self, path: P, output: Option<&str>, ) -> Result<Aligner<Built>, &'static str>
Sets the index, uses the builder pattern. Returns Aligner
Sourcepub fn with_seq(self, seq: &[u8]) -> Result<Aligner<Built>, &'static str>
pub fn with_seq(self, seq: &[u8]) -> Result<Aligner<Built>, &'static str>
Use a single sequence as the index. Sets the sequence ID to “N/A”.
Can not be combined with with_index or set_index.
Following the mappy implementation, this also sets mapopt.mid_occ to 1000.
let aligner = Aligner::builder().map_ont().with_seq(seq.as_bytes()).expect("Unable to build index");
let query = b"CGGCACCAGGTTAAAATCTGAGTGCTGCAATAGGCGATTACAGTACAGCACCCAGCCTCCG";
let hits = aligner.map(query, false, false, None, None, Some(b"Query Name"));
assert_eq!(hits.unwrap().len(), 1);Sourcepub fn with_seq_and_id(
self,
seq: &[u8],
id: &[u8],
) -> Result<Aligner<Built>, &'static str>
pub fn with_seq_and_id( self, seq: &[u8], id: &[u8], ) -> Result<Aligner<Built>, &'static str>
Use a single sequence as the index. Sets the sequence ID to “N/A”.
Can not be combined with with_index or set_index.
Following the mappy implementation, this also sets mapopt.mid_occ to 1000.
let aligner = Aligner::builder().map_ont().with_seq_and_id(seq.as_bytes(), id.as_bytes()).expect("Unable to build index");
let query = b"CGGCACCAGGTTAAAATCTGAGTGCTGCAATAGGCGATTACAGTACAGCACCCAGCCTCCG";
let hits = aligner.map(query, false, false, None, None, Some(b"Sample Query"));
assert_eq!(hits.as_ref().unwrap().len(), 1);
assert_eq!(hits.as_ref().unwrap()[0].target_name.as_ref().unwrap().as_str(), id);Sourcepub fn with_seqs(self, seqs: &[Vec<u8>]) -> Result<Aligner<Built>, &'static str>
pub fn with_seqs(self, seqs: &[Vec<u8>]) -> Result<Aligner<Built>, &'static str>
TODO: Does not work for more than 1 seq currently!
Pass multiple sequences to build an index functionally.
Following the mappy implementation, this also sets mapopt.mid_occ to 1000.
Can not be combined with with_index or set_index.
Sets the sequence IDs to “Unnamed Sequence n” where n is the sequence number.
Sourcepub fn with_seqs_and_ids(
self,
seqs: &[Vec<u8>],
ids: &[Vec<u8>],
) -> Result<Aligner<Built>, &'static str>
pub fn with_seqs_and_ids( self, seqs: &[Vec<u8>], ids: &[Vec<u8>], ) -> Result<Aligner<Built>, &'static str>
TODO: Does not work for more than 1 seq currently! Pass multiple sequences and corresponding IDs to build an index functionally. Following the mappy implementation, this also sets mapopt.mid_occ to 1000.
Sourcepub fn additional_preset(self, preset: Preset) -> Self
pub fn additional_preset(self, preset: Preset) -> Self
Applies an additional preset to the aligner WARNING: This overwrites multiple other parameters. Make sure you know what you are doing
Presets should be called before any other options are set, as they change multiple options at once.
Source§impl Aligner<Built>
impl Aligner<Built>
Sourcepub fn read_junction_lr(&self, bed_path: &str) -> Result<(), i32>
pub fn read_junction_lr(&self, bed_path: &str) -> Result<(), i32>
Load splice/junc data from bed_path into the underlying mm_idx_t.
Equivalent to –junc-bed <bed_path> in minimap2.
Sourcepub fn read_junction(&self, bed_path: &str) -> Result<(), i32>
pub fn read_junction(&self, bed_path: &str) -> Result<(), i32>
Load splice/junc data from bed_path into the underlying mm_idx_t.
Equivalent to -j <bed_path> in minimap2.
pub fn read_splice_scores(&self, file_path: &str) -> Result<(), i32>
Sourcepub fn get_seq<'aln>(&'aln self, i: usize) -> Option<&'aln mm_idx_seq_t>
pub fn get_seq<'aln>(&'aln self, i: usize) -> Option<&'aln mm_idx_seq_t>
Get sequences direct from the index
Returns a reference to the sequence at the given index Remainds valid as long as the aligner is valid
Sourcepub fn map(
&self,
seq: &[u8],
cs: bool,
md: bool,
max_frag_len: Option<usize>,
extra_flags: Option<&[u64]>,
query_name: Option<&[u8]>,
) -> Result<Vec<Mapping>, &'static str>
pub fn map( &self, seq: &[u8], cs: bool, md: bool, max_frag_len: Option<usize>, extra_flags: Option<&[u64]>, query_name: Option<&[u8]>, ) -> Result<Vec<Mapping>, &'static str>
Aligns a given sequence (as bytes) to the index associated with this aligner
For paired-end mapping, use map_pair instead.
Parameters:
seq: Sequence to align
cs: Whether to output CIGAR string
MD: Whether to output MD tag
max_frag_len: Maximum fragment length
extra_flags: Extra flags to pass to minimap2 as Vec<u64>
query_name: Name of the query sequence
Examples found in repository?
159fn worker(
160 work_queue: Arc<ArrayQueue<WorkQueue<WorkUnit>>>,
161 results_queue: Arc<ArrayQueue<WorkQueue<WorkResult>>>,
162 shutdown: Arc<std::sync::atomic::AtomicBool>,
163 aligner: Arc<Aligner<Built>>,
164) {
165 loop {
166 // We use backoff to sleep when we don't have any work
167 let backoff = crossbeam::utils::Backoff::new();
168
169 match work_queue.pop() {
170 Some(WorkQueue::Work(sequence)) => {
171 let alignment = aligner
172 .map(&sequence.1, true, false, None, None, Some(&sequence.0))
173 .expect("Unable to align");
174
175 // Return the original sequence, as well as the mappings
176 // We have to do it this way because ownership
177 let mut result = WorkQueue::Result((sequence, alignment));
178 while let Err(result_packet) = results_queue.push(result) {
179 result = result_packet; // Simple way to maintain ownership
180 // If we have an error, it's 99% because the queue is full
181 backoff.snooze();
182 }
183 }
184 Some(_) => unimplemented!("Unexpected work type"),
185 None => {
186 backoff.snooze();
187
188 // If we have the shutdown signal, we should exit
189 if shutdown.load(std::sync::atomic::Ordering::Relaxed) && work_queue.is_empty() {
190 break;
191 }
192 }
193 }
194 }
195}More examples
32fn map(
33 target_file: impl AsRef<Path>,
34 query_file: impl AsRef<Path>,
35 threads: usize,
36) -> Result<(), Box<dyn Error>> {
37 // Set the number of threads to use
38 rayon::ThreadPoolBuilder::new()
39 .num_threads(threads)
40 .build_global()
41 .expect("Unable to set number of threads");
42
43 println!("Creating index");
44
45 // Aligner gets created using the build pattern.
46 // Once .with_index is called, the aligner is set to "Built" and can no longer be changed.
47 let aligner = Aligner::builder()
48 .map_ont()
49 .with_cigar()
50 .with_index_threads(threads) // Minimap2 uses it's own thread pool for index building
51 .with_index(target_file, None)
52 .expect("Unable to build index");
53
54 println!("Index created");
55
56 // Read in the query file
57 let mut reader = parse_fastx_file(query_file)?;
58
59 let mut queries: Vec<(Vec<u8>, Vec<u8>)> = Vec::new();
60 while let Some(record) = reader.next() {
61 let record = record.expect("Error reading record");
62 queries.push((record.id().to_vec(), record.seq().to_vec()));
63 }
64
65 // Map the queries
66 let results: Vec<Vec<Mapping>> = queries
67 .par_iter()
68 .map(|(id, seq)| {
69 aligner
70 .map(&seq, false, false, None, None, Some(&id))
71 .expect("Error mapping")
72 })
73 .collect();
74
75 // Count total number of alignments
76 let total_alignments: usize = results.iter().map(|x| x.len()).sum();
77 println!("Iteration complete, total alignments {}", total_alignments);
78
79 Ok(())
80}Sourcepub fn map_pair(
&self,
seq1: &[u8],
seq2: &[u8],
cs: bool,
md: bool,
max_frag_len: Option<usize>,
extra_flags: Option<&[u64]>,
query_name: Option<&[u8]>,
) -> Result<(Vec<Mapping>, Vec<Mapping>), &'static str>
pub fn map_pair( &self, seq1: &[u8], seq2: &[u8], cs: bool, md: bool, max_frag_len: Option<usize>, extra_flags: Option<&[u64]>, query_name: Option<&[u8]>, ) -> Result<(Vec<Mapping>, Vec<Mapping>), &'static str>
Aligns a pair of sequences (paired-end reads) to the index.
This method uses minimap2’s mm_map_frag function internally to perform
paired-end alignment, which considers the expected fragment length and
orientation of read pairs.
§Parameters
seq1- First read sequence (read 1)seq2- Second read sequence (read 2)cs- Whether to output CS tagmd- Whether to output MD tagmax_frag_len- Maximum fragment length (insert size). If None, uses default.extra_flags- Extra flags to pass to minimap2query_name- Name of the read pair
§Returns
A tuple of (Vec<Mapping>, Vec<Mapping>) where the first vector contains
mappings for read 1 and the second contains mappings for read 2.
§Example
use minimap2::Aligner;
let aligner = Aligner::builder()
.sr() // short-read preset for paired-end
.with_cigar()
.with_index("reference.fa", None)
.expect("Unable to build index");
let read1 = b"ACGTACGTACGTACGT";
let read2 = b"TGCATGCATGCATGCA";
let (mappings1, mappings2) = aligner.map_pair(
read1, read2,
false, false,
Some(500),
None,
Some(b"read_pair_001"),
).expect("Unable to align");Sourcepub fn map_file(
&self,
file: &str,
cs: bool,
md: bool,
) -> Result<Vec<Mapping>, &'static str>
pub fn map_file( &self, file: &str, cs: bool, md: bool, ) -> Result<Vec<Mapping>, &'static str>
Map entire file Detects if file is gzip or not and if it’s fastq/fasta or not Best for smaller files (all results are stored in an accumulated Vec!) What you probably want is to loop through the file yourself and use the map() function
TODO: Remove cs and md and make them options on the struct
pub fn has_index(&self) -> bool
Sourcepub fn score_junctions(&self, mapping: &Mapping, junctions: &mut Vec<Junction>)
pub fn score_junctions(&self, mapping: &Mapping, junctions: &mut Vec<Junction>)
Provides a mapping with a splice score
User must provide a junctions vector to store the junctions and their associated scores.
The junctions vector will NOT be cleared and is extended with one entry per junction.
Adapted from https://github.com/lh3/minimap2/blob/1fd85be6e2515c9194740e1d2e6a2625be36f508/format.c#L263
Note: to score junctions .with_cigar() must called.