Struct minimap2::Aligner

pub struct Aligner {
    pub idxopt: IdxOpt,
    pub mapopt: MapOpt,
    pub threads: usize,
    pub idx: Option<mm_idx_t>,
    pub idx_reader: Option<mm_idx_reader_t>,
    pub cigar_clipping: bool,
}

Aligner struct, mimicking minimap2’s python interface

Aligner::builder();

Fields

idxopt: IdxOpt

Index options passed to minimap2 (mm_idxopt_t)

mapopt: MapOpt

Mapping options passed to minimap2 (mm_mapopt_t)

threads: usize

Number of threads to create the index with

idx: Option<mm_idx_t>

Index created by minimap2

idx_reader: Option<mm_idx_reader_t>

Index reader created by minimap2

cigar_clipping: bool

Whether to add soft clipping to CIGAR result

Implementations

impl Aligner

pub fn populate_header(&self, header: &mut Header)

pub fn map_to_sam( &self, seq: &[u8], qual: Option<&[u8]>, name: Option<&[u8]>, header: &HeaderView, max_frag_len: Option<usize>, extra_flags: Option<Vec<u64>> ) -> Result<Vec<Record>, &'static str>

impl Aligner

pub fn builder() -> Self

Create a new aligner with default options

impl Aligner

pub fn lrhq(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to lr:hq.

pub fn splice(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to splice

Aligner::builder().splice();

pub fn splice_hq(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to splice:hq

Aligner::builder().splice_hq();

pub fn asm(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to Asm

Aligner::builder().asm();

pub fn asm5(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to Asm5

Aligner::builder().asm5();

pub fn asm10(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to Asm10

Aligner::builder().asm10();

pub fn asm20(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to Asm20

Aligner::builder().asm20();

pub fn sr(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to sr

Aligner::builder().sr();

pub fn map_pb(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to MapPb

Aligner::builder().map_pb();

pub fn map_hifi(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to MapHifi

Aligner::builder().map_hifi();

pub fn map_ont(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to MapOnt.

Aligner::builder().map_ont();

pub fn ava_pb(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to AvaPb

Aligner::builder().ava_pb();

pub fn ava_ont(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to AvaOnt.

Aligner::builder().ava_ont();

pub fn short(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to Short

Aligner::builder().short();

pub fn map10k(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to Map10k

Aligner::builder().map10k();

pub fn cdna(self) -> Self

Ergonomic function for Aligner. Sets the minimap2 preset to cdna

Aligner::builder().cdna();

pub fn preset(self, preset: Preset) -> Self

Create an aligner using a preset.

pub fn with_cigar(self) -> Self

Set Alignment mode / cigar mode in minimap2

Aligner::builder().map_ont().with_cigar();

pub fn with_cigar_clipping(self) -> Self

pub fn with_sam_out(self) -> Self

pub fn with_sam_hit_only(self) -> Self

pub fn with_index_threads(self, threads: usize) -> Self

Sets the number of threads minimap2 will use for building the index

Aligner::builder().with_index_threads(10);

Set the number of threads (prefer to use the struct config)

pub fn with_threads(self, threads: usize) -> Self

👎Deprecated since 0.1.17: Please use with_index_threads instead

pub fn with_index<P>( self, path: P, output: Option<&str> ) -> Result<Self, &'static str>

where P: AsRef<Path>,

Set index parameters for minimap2 using builder pattern Creates the index as well with the given number of threads (set at struct creation). You must set the number of threads before calling this function.

Parameters: path: Location of pre-built index or FASTA/FASTQ file (may be gzipped or plaintext) Output: Option (None) or a filename

Returns the aligner with the index set

// Do not save the index file
Aligner::builder().map_ont().with_index("test_data/test_data.fasta", None);

// Save the index file as my_index.mmi
Aligner::builder().map_ont().with_index("test_data/test_data.fasta", Some("my_index.mmi"));

// Use the previously built index
Aligner::builder().map_ont().with_index("my_index.mmi", None);

pub fn set_index<P>( &mut self, path: P, output: Option<&str> ) -> Result<(), &'static str>

where P: AsRef<Path>,

Set the index (in-place, without builder pattern)

pub fn with_seq(self, seq: &[u8]) -> Result<Self, &'static str>

Use a single sequence as the index. Sets the sequence ID to “N/A”. Can not be combined with with_index or set_index. Following the mappy implementation, this also sets mapopt.mid_occ to 1000.

let aligner = Aligner::builder().map_ont().with_seq(seq.as_bytes()).expect("Unable to build index");
let query = b"CGGCACCAGGTTAAAATCTGAGTGCTGCAATAGGCGATTACAGTACAGCACCCAGCCTCCG";
let hits = aligner.map(query, false, false, None, None);
assert_eq!(hits.unwrap().len(), 1);

pub fn with_seq_and_id( self, seq: &[u8], id: &[u8] ) -> Result<Self, &'static str>

Use a single sequence as the index. Sets the sequence ID to “N/A”. Can not be combined with with_index or set_index. Following the mappy implementation, this also sets mapopt.mid_occ to 1000.

let aligner = Aligner::builder().map_ont().with_seq_and_id(seq.as_bytes(), id.as_bytes()).expect("Unable to build index");
let query = b"CGGCACCAGGTTAAAATCTGAGTGCTGCAATAGGCGATTACAGTACAGCACCCAGCCTCCG";
let hits = aligner.map(query, false, false, None, None);
assert_eq!(hits.as_ref().unwrap().len(), 1);
assert_eq!(hits.as_ref().unwrap()[0].target_name.as_ref().unwrap(), id);

pub fn with_seqs(self, seqs: &[Vec<u8>]) -> Result<Self, &'static str>

TODO: Does not work for more than 1 seq currently! Pass multiple sequences to build an index functionally. Following the mappy implementation, this also sets mapopt.mid_occ to 1000. Can not be combined with with_index or set_index. Sets the sequence IDs to “Unnamed Sequence n” where n is the sequence number.

pub fn with_seqs_and_ids( self, seqs: &[Vec<u8>], ids: &[Vec<u8>] ) -> Result<Self, &'static str>

TODO: Does not work for more than 1 seq currently! Pass multiple sequences and corresponding IDs to build an index functionally. Following the mappy implementation, this also sets mapopt.mid_occ to 1000.

pub fn map( &self, seq: &[u8], cs: bool, md: bool, max_frag_len: Option<usize>, extra_flags: Option<&[u64]> ) -> Result<Vec<Mapping>, &'static str>

Aligns a given sequence (as bytes) to the index associated with this aligner

Parameters: seq: Sequence to align cs: Whether to output CIGAR string MD: Whether to output MD tag max_frag_len: Maximum fragment length extra_flags: Extra flags to pass to minimap2 as Vec<u64>

pub fn map_file( &self, file: &str, cs: bool, md: bool ) -> Result<Vec<Mapping>, &'static str>

Map entire file Detects if file is gzip or not and if it’s fastq/fasta or not Best for smaller files (all results are stored in an accumulated Vec!) What you probably want is to loop through the file yourself and use the map() function

TODO: Remove cs and md and make them options on the struct

pub fn has_index(&self) -> bool

Trait Implementations

impl Clone for Aligner

fn clone(&self) -> Aligner

Returns a copy of the value.

fn clone_from(&mut self, source: &Self)

Performs copy-assignment from source.

impl Default for Aligner

Create a default aligner

fn default() -> Self

Returns the “default value” for a type.

impl From<&Aligner> for MMIndex

fn from(aligner: &Aligner) -> Self

Converts to this type from the input type.

impl Send for Aligner

impl Sync for Aligner