Struct StreamingQuery 

pub struct StreamingQuery<const K: usize>
where
    Kmer<K>: KmerBits,
{ /* private fields */ }

Streaming query engine for efficient consecutive k-mer lookups

This struct maintains state across multiple lookups to optimize queries for sliding windows over sequences.

Example

use sshash_lib::streaming_query::StreamingQuery;
// Assuming we have a dictionary...
// let mut query = StreamingQuery::new(&dict, true); // canonical=true
// 
// Process consecutive k-mers efficiently
// let result1 = query.lookup("ACGTACGTACGTACGTACGTACGTACGTACG");
// let result2 = query.lookup("CGTACGTACGTACGTACGTACGTACGTACGT"); // Sliding by 1

Implementations

impl<const K: usize> StreamingQuery<K>

where Kmer<K>: KmerBits,

pub fn new(k: usize, m: usize, canonical: bool) -> Self

Create a new streaming query engine

Arguments

• k - K-mer size
• m - Minimizer size
• canonical - Whether to use canonical k-mers (min of forward/RC)

pub fn reset(&mut self)

Reset the query state (call this when starting a new sequence)

pub fn lookup(&mut self, kmer_bytes: &[u8]) -> LookupResult

Perform a streaming lookup for a k-mer

This is the main entry point for queries. For optimal performance, call this with consecutive k-mers (sliding by 1 base at a time).

Arguments

• kmer_str - DNA string of length K

Returns

A LookupResult indicating whether the k-mer was found and its location

pub fn lookup_with_dict( &mut self, kmer_bytes: &[u8], dict: &Dictionary, ) -> LookupResult

Perform a streaming lookup with dictionary integration.

Accepts a &Dictionary at call time rather than storing a reference, so callers can manage the dictionary’s lifetime independently (e.g. via Arc).

pub fn num_searches(&self) -> u64

Get the number of full searches performed

pub fn num_extensions(&self) -> u64

Get the number of extensions (no search needed)

pub fn num_positive_lookups(&self) -> u64

Get the number of positive lookups (found)

pub fn num_negative_lookups(&self) -> u64

Get the number of negative lookups (not found)

pub fn num_invalid_lookups(&self) -> u64

Get the number of invalid lookups (malformed input)