Struct SeedNtHashBuilder 

pub struct SeedNtHashBuilder<'a> { /* private fields */ }

Builder for creating a SeedNtHashIter, providing ergonomic configuration.

Example:

use nthash_rs::{SeedNtHashBuilder, Result};

let seq   = b"ATCGTACGATGCATGCATGCTGACG";
let masks = vec!["000111", "010101"];

for (pos, hashes) in SeedNtHashBuilder::new(seq)
                       .k(6)
                       .masks(masks)
                       .num_hashes(2)
                       .finish()? {
    println!("{pos:2}  {:016x}", hashes[0]);
}

Implementations

impl<'a> SeedNtHashBuilder<'a>

pub fn new(seq: &'a [u8]) -> Self

Starts building a new ntHash configuration from the given sequence.

pub fn k(self, k: u16) -> Self

Sets the k-mer size.

pub fn masks<S: Into<String>, I: IntoIterator<Item = S>>(self, m: I) -> Self

Adds seed masks where ‘1’ indicates positions to hash.

pub fn num_hashes(self, n: usize) -> Self

Specifies number of hashes per spaced seed.

pub fn pos(self, p: usize) -> Self

Sets the start position in the sequence.

pub fn finish(self) -> Result<SeedNtHashIter<'a>>

Finalizes the builder and returns an iterator over the hashes.

Trait Implementations

impl<'a> IntoIterator for SeedNtHashBuilder<'a>

type Item = (usize, Vec<u64>)

The type of the elements being iterated over.

type IntoIter = SeedNtHashIter<'a>

Which kind of iterator are we turning this into?

fn into_iter(self) -> Self::IntoIter

Creates an iterator from a value.