Struct ContigConfig 

#[non_exhaustive]
pub struct ContigConfig {
    pub number: NonZeroU32,
    pub len_range: OrdPair<NonZeroU64>,
    pub repeated_seq: Option<DNARestrictive>,
}

Configuration for contig generation

The struct contains parameters which can then be passed to other functions to construct the actual contig. Also refer to SimulationConfig to see how this struct can be used, and ContigConfigBuilder for how to build this (as shown below in the examples).

Examples

Request two contigs with lengths randomly chosen from 1000 - 2000 bp. The DNA of the contigs are randomly-generated.

use nanalogue_core::Error;
use nanalogue_core::simulate_mod_bam::ContigConfigBuilder;

let contig_config = ContigConfigBuilder::default()
    .number(2)
    .len_range((1000,2000)).build()?;

Request similar contigs as above but with the DNA of the contigs consisting of the same sequence repeated over and over.

let contig_config = ContigConfigBuilder::default()
    .number(2)
    .len_range((1000,2000))
    .repeated_seq("AAGCTTGA".into()).build()?;

Request a contig with a fixed length and sequence. As the repeated sequence’s length is equal to the contig length, and the contig length is precisely fixed, you get a non-randomly generated contig.

let contig_config = ContigConfigBuilder::default()
    .number(1)
    .len_range((20,20))
    .repeated_seq("ACGTACGTACGTACGTACGT".into()).build()?;

Fields (Non-exhaustive)

Non-exhaustive structs could have additional fields added in future. Therefore, non-exhaustive structs cannot be constructed in external crates using the traditional Struct { .. } syntax; cannot be matched against without a wildcard ..; and struct update syntax will not work.

number: NonZeroU32

Number of contigs to generate

len_range: OrdPair<NonZeroU64>

Contig length range in bp [min, max]

repeated_seq: Option<DNARestrictive>

Optional repeated sequence to use for contigs instead of random generation

Trait Implementations

impl Clone for ContigConfig

fn clone(&self) -> ContigConfig

Returns a duplicate of the value.

fn clone_from(&mut self, source: &Self)

Performs copy-assignment from source.

impl Debug for ContigConfig

fn fmt(&self, f: &mut Formatter<'_>) -> Result

Formats the value using the given formatter.

impl Default for ContigConfig

fn default() -> Self

Returns the “default value” for a type.

impl<'de> Deserialize<'de> for ContigConfig

where ContigConfig: Default,

fn deserialize<__D>(__deserializer: __D) -> Result<Self, __D::Error>

where __D: Deserializer<'de>,

Deserialize this value from the given Serde deserializer.

impl PartialEq for ContigConfig

fn eq(&self, other: &ContigConfig) -> bool

Tests for self and other values to be equal, and is used by ==.

fn ne(&self, other: &Rhs) -> bool

Tests for !=. The default implementation is almost always sufficient, and should not be overridden without very good reason.

impl Serialize for ContigConfig

fn serialize<__S>(&self, __serializer: __S) -> Result<__S::Ok, __S::Error>

where __S: Serializer,

Serialize this value into the given Serde serializer.

impl StructuralPartialEq for ContigConfig