Crate lightmotif_py
source ·Expand description
🎼🧬 lightmotif

A lightweight platform-accelerated library for biological motif scanning using position weight matrices.
🗺️ Overview
Motif scanning with position weight matrices (also known as position-specific scoring matrices) is a robust method for identifying motifs of fixed length inside a biological sequence. They can be used to identify transcription factor binding sites in DNA, or protease cleavage site in polypeptides. Position weight matrices are often viewed as sequence logos:
The lightmotif
library provides a Python module to run very efficient
searches for a motif encoded in a position weight matrix. The position
scanning combines several techniques to allow high-throughput processing
of sequences:
- Compile-time definition of alphabets and matrix dimensions.
- Sequence symbol encoding for fast table look-ups, as implemented in HMMER[1] or MEME[2]
- Striped sequence matrices to process several positions in parallel, inspired by Michael Farrar[3].
- Vectorized matrix row look-up using
permute
instructions of AVX2.
This is the Python version, there is a Rust crate available as well.
🔧 Installing
lightmotif
can be installed directly from PyPI,
which hosts some pre-built wheels for most mainstream platforms, as well as the
code required to compile from source with Rust:
$ pip install lightmotif
In the event you have to compile the package from source, all the required Rust libraries are vendored in the source distribution, and a Rust compiler will be setup automatically if there is none on the host machine.
💡 Example
The motif interface should be mostly compatible with the
Bio.motifs
module from Biopython. The notable difference is that
the calculate
method of PSSM objects expects a striped sequence instead.
import lightmotif
# Create a count matrix from an iterable of sequences
motif = lightmotif.create(["GTTGACCTTATCAAC", "GTTGATCCAGTCAAC"])
# Create a PSSM with 0.1 pseudocounts and uniform background frequencies
pwm = motif.counts.normalize(0.1)
pssm = pwm.log_odds()
# Encode the target sequence into a striped matrix
seq = "ATGTCCCAACAACGATACCCCGAGCCCATCGCCGTCATCGGCTCGGCATGCAGATTCCCAGGCG"
striped = lightmotif.stripe(seq)
# Compute scores using the fastest backend implementation for the host machine
scores = pssm.calculate(sseq)
⏱️ Benchmarks
Benchmarks use the MX000001
motif from PRODORIC[4], and the
complete genome of an
Escherichia coli K12 strain.
Benchmarks were run on a i7-10710U CPU running @1.10GHz, compiled with --target-cpu=native
.
lightmotif (avx2): 5,335,999 ns/iter (+/- 3,532,171) = 829.6 MiB/s
Bio.motifs: 346,620,369 ns/iter (+/- 35,120,487) = 12.8 MiB/s
MOODS.scan: 161,808,252 ns/iter (+/- 8,677,959) = 27.4 MiB/s
💭 Feedback
⚠️ Issue Tracker
Found a bug ? Have an enhancement request ? Head over to the GitHub issue tracker if you need to report or ask something. If you are filing in on a bug, please include as much information as you can about the issue, and try to recreate the same bug in a simple, easily reproducible situation.
📋 Changelog
This project adheres to Semantic Versioning and provides a changelog in the Keep a Changelog format.
⚖️ License
This library is provided under the open-source MIT license.
This project was developed by Martin Larralde during his PhD project at the European Molecular Biology Laboratory in the Zeller team.
📚 References
- [1] Eddy, Sean R. ‘Accelerated Profile HMM Searches’. PLOS Computational Biology 7, no. 10 (20 October 2011): e1002195. doi:10.1371/journal.pcbi.1002195.
- [2] Grant, Charles E., Timothy L. Bailey, and William Stafford Noble. ‘FIMO: Scanning for Occurrences of a given Motif’. Bioinformatics 27, no. 7 (1 April 2011): 1017–18. doi:10.1093/bioinformatics/btr064.
- [3] Farrar, Michael. ‘Striped Smith–Waterman Speeds Database Searches Six Times over Other SIMD Implementations’. Bioinformatics 23, no. 2 (15 January 2007): 156–61. doi:10.1093/bioinformatics/btl582.
- [4] Dudek, Christian-Alexander, and Dieter Jahn. ‘PRODORIC: State-of-the-Art Database of Prokaryotic Gene Regulation’. Nucleic Acids Research 50, no. D1 (7 January 2022): D295–302. doi:10.1093/nar/gkab1110.
Structs
- A matrix storing the count of a motif letters at each position.
- A biological sequence encoded as digits.
- A matrix storing position-specific odds-ratio for a motif.
- A striped matrix storing scores obtained with a scoring matrix.
- An encoded biological sequence stored in a column-major matrix.
- A matrix storing position-specific odds-ratio for a motif.
Functions
- Create a new motif from an iterable of sequences.
- PyO3 bindings to
lightmotif
, a library for fast PWM motif scanning. - Encode and stripe a text sequence.