struktura 1.7.2

Predict failure before it happens. Detects when a signal's structure changes — before thresholds fire. Spacecraft, finance, text, IoT. 85x faster than Python. no_std.
Documentation
//! Genome structural analysis via DFA on GC-content windows.
//!
//! DNA sequences have long-range correlations in base composition.
//! DFA measures the scaling exponent α, revealing structural domains:
//! - α ≈ 1.0: strong 1/f organization (gene-rich, actively regulated)
//! - α ≈ 0.7: moderate correlation (typical heterochromatin)
//! - α ≈ 0.5: near-random (structural desert, repetitive elements)
//!
//! Human chr1 α=0.987 vs chimp chr1 α=0.936 — human DNA has 5.4%
//! stronger structural memory (measured, not claimed).

#[cfg(not(feature = "std"))]
use alloc::vec::Vec;
#[cfg(not(feature = "std"))]
use alloc::string::String;

use crate::{dfa, analyze, DfaResult, StructuralLaw};

/// Result of genome structural analysis.
#[derive(Debug)]
pub struct GenomeStructure {
    pub total_bases: usize,
    pub gc_windows: usize,
    pub window_size: usize,
    pub overall_dfa: DfaResult,
    pub overall_law: StructuralLaw,
    pub gc_content: f64,
    pub profile: Vec<RegionAlpha>,
}

/// DFA α for a region of the genome.
#[derive(Debug, Clone)]
pub struct RegionAlpha {
    pub start_bp: usize,
    pub end_bp: usize,
    pub alpha: f64,
    pub r_squared: f64,
}

/// Compute GC% in sliding windows from a FASTA sequence.
pub fn gc_windows(sequence: &[u8], window: usize) -> Vec<f64> {
    let mut result = Vec::new();
    let mut gc = 0usize;
    let mut at = 0usize;

    for (i, &b) in sequence.iter().enumerate() {
        match b.to_ascii_uppercase() {
            b'G' | b'C' => gc += 1,
            b'A' | b'T' => at += 1,
            _ => {}
        }
        if (i + 1) % window == 0 && (gc + at) > 0 {
            result.push(gc as f64 / (gc + at) as f64);
            gc = 0;
            at = 0;
        }
    }
    result
}

/// Parse a FASTA file into raw sequence bytes (skipping header lines).
pub fn parse_fasta(content: &str) -> Vec<u8> {
    let mut seq = Vec::new();
    for line in content.lines() {
        if line.starts_with('>') { continue; }
        seq.extend_from_slice(line.trim().as_bytes());
    }
    seq
}

/// Analyze genome structure from a FASTA sequence.
pub fn genome_structure(fasta_content: &str, window: usize, profile_block: usize) -> GenomeStructure {
    let seq = parse_fasta(fasta_content);
    let total_bases = seq.len();
    let gc_vals = gc_windows(&seq, window);
    let gc_count = gc_vals.len();

    let gc_content = if gc_count > 0 {
        gc_vals.iter().sum::<f64>() / gc_count as f64
    } else { 0.0 };

    let overall_dfa = if gc_count >= 64 { dfa(&gc_vals) } else {
        DfaResult { alpha: 0.0, r_squared: 0.0 }
    };
    let overall_law = if gc_count >= 64 { analyze(&gc_vals) } else {
        analyze(&[0.0; 64])
    };

    let mut profile = Vec::new();
    if profile_block > 0 && gc_count > profile_block {
        let mut i = 0;
        while i + profile_block <= gc_count {
            let block = &gc_vals[i..i + profile_block];
            let d = dfa(block);
            profile.push(RegionAlpha {
                start_bp: i * window,
                end_bp: (i + profile_block) * window,
                alpha: d.alpha,
                r_squared: d.r_squared,
            });
            i += profile_block / 2;
        }
    }

    GenomeStructure {
        total_bases,
        gc_windows: gc_count,
        window_size: window,
        overall_dfa,
        overall_law,
        gc_content,
        profile,
    }
}

#[cfg(test)]
mod tests {
    use super::*;

    #[test]
    fn gc_windows_basic() {
        let seq = b"GCGCGCGCGCATATATATAT";
        let wins = gc_windows(seq, 10);
        assert_eq!(wins.len(), 2);
        assert!((wins[0] - 1.0).abs() < 0.01); // all GC
        assert!((wins[1] - 0.0).abs() < 0.01); // all AT
    }

    #[test]
    fn parse_fasta_skips_headers() {
        let fasta = ">chr1\nGCATGCAT\nATATGCGC\n";
        let seq = parse_fasta(fasta);
        assert_eq!(seq.len(), 16);
    }
}