# Strobemers
A Rust crate to generate strobemers. Strobemers are a type of fuzzy seed originally designed for bioinformatics use-cases to perform well with substitutions and especially insertions/deletions. For more information see the paper: [Kristoffer Sahlin, Effective sequence similarity detection with strobemers, Genome Res. November 2021 31: 2080-2094](https://genome.cshlp.org/content/31/11/2080)
This crate is currently intended to generate identical strobemers as the original C++ implementation [here](https://github.com/ksahlin/strobemers/tree/main).
Currently only randstrobes order 2 and 3 are supported.
# Usage example
```
use strobemers::Randstrobe;
fn main() {
let reference = b"ACGCGTACGAATCACGCCGGGTGTGTGTGATCG";
let n: usize = 2;
let k: usize = 15;
let w_min: usize = 16;
let w_max: usize = 30;
let randstrobe_iter = Randstrobe::new(reference, n, k, w_min, w_max).unwrap();
for strobe in randstrobe_iter {
println!("randstrobe start positions: {:?}", strobe);
}
}
```