strobemers 0.1.0

A strobemer implementation
Documentation
# Strobemers

A Rust crate to generate strobemers. Strobemers are a type of fuzzy seed originally designed for bioinformatics use-cases to perform well with substitutions and especially insertions/deletions. For more information see the paper: [Kristoffer Sahlin, Effective sequence similarity detection with strobemers, Genome Res. November 2021 31: 2080-2094](https://genome.cshlp.org/content/31/11/2080)

This crate is currently intended to generate identical strobemers as the original C++ implementation [here](https://github.com/ksahlin/strobemers/tree/main).


Currently only randstrobes order 2 and 3 are supported.


# Usage example

```
use strobemers::Randstrobe;

fn main() {
    let reference = b"ACGCGTACGAATCACGCCGGGTGTGTGTGATCG";
    let n: usize = 2;
    let k: usize = 15;
    let w_min: usize = 16;
    let w_max: usize = 30;

    let randstrobe_iter = Randstrobe::new(reference, n, k, w_min, w_max).unwrap();
    for strobe in randstrobe_iter {
        println!("randstrobe start positions: {:?}", strobe);
    }
}
```