sshash-lib 0.3.0

Sparse and Skew Hashing of k-mers - Core library
Documentation

sshash-lib

Core library for SSHash-rs: a compressed k-mer dictionary based on sparse and skew hashing.

Quick Start

use sshash_lib::{Dictionary, Kmer, KmerBits};

type Kmer31 = Kmer<31>;

fn main() -> Result<(), Box<dyn std::error::Error>> {
    // Load a previously built index
    let dict = Dictionary::load("index")?;

    // Single k-mer lookup (returns position or INVALID_UINT64)
    let kmer = Kmer31::from_string("ACGTACGTACGTACGTACGTACGTACGTACG")?;
    let pos = dict.lookup::<31>(&kmer);

    // Streaming queries over a sequence
    let mut engine = dict.create_streaming_query::<31>();

    Ok(())
}

Modules

Module Purpose
dictionary Load, save, lookup, and query k-mers
builder Index construction pipeline
streaming_query Efficient sequential k-mer processing
kmer Kmer<K> with const-generic sizing and bit-parallel ops
minimizer Minimizer extraction and iteration
minimizers_control_map MPHF-based minimizer→bucket mapping
spectrum_preserving_string_set SPSS: unitig storage and position lookup
sparse_and_skew_index Bucket dispatch (singleton / light / heavy)
offsets Elias-Fano encoded string boundary offsets

License

MIT