<div align="center">
<img src="images/logo.svg" width="125" />
<h1><code>SigAlign</code></h1>
<p>
A <b>Si</b>milarity-<b>G</b>uided <b>Align</b>ment Algorithm
</p>
<p>
<a href="https://github.com/baku4/sigalign/actions/workflows/build_and_test.yml" target="_blank">
<img alt="CI" src="https://img.shields.io/github/actions/workflow/status/baku4/sigalign/build_and_test.yml?style=flat-square&label=build%20%26%20test">
</a>
<a href="https://github.com/baku4/sigalign/" target="_blank"><img alt="License" src="https://img.shields.io/github/license/baku4/sigalign?style=flat-square"></a>
<br>
<a href="https://crates.io/crates/sigalign/" target="_blank"><img alt="Crates.io" src="https://img.shields.io/crates/v/sigalign.svg?style=flat-square&logo=rust"></a>
<img alt="Crates.io MSRV" src="https://img.shields.io/crates/msrv/sigalign?style=flat-square&logo=rust">
<img alt="docs.rs" src="https://img.shields.io/docsrs/sigalign?style=flat-square&logo=docsdotrs">
<a href="https://pypi.org/project/sigalign/" target="_blank"><img alt="PyPI" src="https://img.shields.io/pypi/v/sigalign?style=flat-square&logo=python&logoColor=white"></a>
</p>
</div>
## What is `SigAlign`?
SigAlign is a library for **biological sequence alignment**, the process of matching two sequences to identify similarity, which is a crucial step in analyzing sequence data in bioinformatics and computational biology. If you are new to sequence alignment, a quick overview on [Wikipedia](https://en.wikipedia.org/wiki/Sequence_alignment) will be helpful.
SigAlign is a **non-heuristic** algorithm that outputs alignments satisfying two cutoffs:
1. **Minimum Length**
2. **Maximum Penalty per Length**
In SigAlign, the penalty is calculated based on a **gap-affine scheme**, which imposes different penalties on mismatches, gap openings, and gap extensions.
### Core Purpose
SigAlign is designed to be:
- ⚡️ **Fast** to collect highly similar alignments
- 💡 **Easy** to customize and explain results
- 🧱 **Small and flexible** to be a basic building block for other tools
SigAlign is **not** intended to:
- Align ultra-long reads
- Search for low similarity alignments
## Quick Start Examples
### For `Rust` developer
- As a Rust library, SigAlign can take advantage of the most abundant features in Rust.
- Registered on `crates.io`: https://crates.io/crates/sigalign/
- API documentation: https://docs.rs/sigalign/
```rust
use sigalign::{
Aligner,
algorithms::Local,
ReferenceBuilder,
};
// (1) Build `Reference`
let fasta =
br#">target_1
ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
>target_2
TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC"#;
let reference = ReferenceBuilder::new()
.set_uppercase(true) // Ignore case
.ignore_base(b'N') // 'N' is never matched
.add_fasta(&fasta[..]).unwrap() // Add sequences from FASTA
.add_target(
"target_3",
b"AAAAAAAAAAA",
) // Add sequence manually
.build().unwrap();
// (2) Initialize `Aligner`
let algorithm = Local::new(
4, // Mismatch penalty
6, // Gap-open penalty
2, // Gap-extend penalty
50, // Minimum length
0.2, // Maximum penalty per length
).unwrap();
let mut aligner = Aligner::new(algorithm);
// (3) Align query to reference
let query = b"CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA";
let result = aligner.align(query, &reference);
println!("{:#?}", result);
```
### For `Python` developer
- SigAlign's Python binding is available on PyPI: https://pypi.org/project/sigalign/
- Use `pip` to install the package: `pip install sigalign`
```python
from sigalign import Reference, Aligner
# (1) Construct `Reference`
reference = Reference.from_fasta_file("./YOUR_REFERENCE.fa")
# (2) Initialize `Aligner`
aligner = Aligner(4, 6, 2, 50, 0.2)
# (3) Execute Alignment
query = "CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA"
results = aligner.align_query(reference, query)
# (4) Display Results
for target_result in results:
print(f"# Target index: {target_result.index}")
for idx, alignment in enumerate(target_result.alignments):
print(f" - Result: {idx+1}")
print(f" - Penalty: {alignment.penalty}")
print(f" - Length: {alignment.length}")
print(f" - Query position: {alignment.query_position}")
print(f" - Target position: {alignment.target_position}")
```
### For `Web` developer
- SigAlign offers a WebAssembly (WASM) build, opening up the potential for web-based applications. While it is not currently available through package managers such as `npm`, plans for web support are in the pipeline.
- An exemplary WASM implementation can be found within the `example` directory. Below is a TypeScript example showcasing SigAlign's application via this WASM wrapper:
```ts
import init, { Reference, Aligner, type AlignmentResult } from '../wasm/sigalign_demo_wasm';
async function run() {
await init();
// (1) Construct `Reference`
const fasta: string = `>target_1
ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
>target_2
TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC`;
const reference: Reference = await Reference.build(fasta);
// (2) Initialize `Aligner`
const aligner: Aligner = new Aligner(
4, // Mismatch penalty
6, // Gap-open penalty
2, // Gap-extend penalty
50, // Minimum aligned length
0.2, // Maximum penalty per length
);
// (3) Execute Alignment
const query: string = "CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA";
const result: AlignmentResult = await aligner.alignment(query, reference);
// (4) Parse and Display Results
const parsedJsonObj = JSON.parse(result.to_json());
console.log(parsedJsonObj);
}
run();
```
- To gain further insight into web-based implementation of SigAlign, visit the SigAlign [tour page](https://baku4.github.io/sigalign/). This page utilizes the WASM wrapper exemplified above.
## License
SigAlign is released under the [MIT License]((https://github.com/baku4/sigalign/blob/main/LICENSE)).
## Citation
Bahk, K., & Sung, J. (2024). SigAlign: an alignment algorithm guided by explicit similarity criteria. *Nucleic Acids Research*, 52(15), 8717-8733.