sigalign 0.3.3

A Similarity-Guided Alignment Algorithm
Documentation

Key Features

Simplified Parameters

  • Gap-Affine Penalties: SigAlign incorporates a gap-affine penalty-based scoring scheme that promotes continuous gaps to reflect the complexity of biological sequences. The gap-affine penalty system is composed of:
    1. Mismatch Penalty
    2. Gap-Open Penalty
    3. Gap-Extend Penalty
  • Similarity Cutoffs: Defining a clear boundary for alignment results, SigAlign uses two key criteria:
    1. Minimum Length (ML)
    2. Maximum Penalty per Length (MPL)

Clear Boundary of Results

  • If there is no alignment result, the global optimum does not satisfy the cutoff.
  • If there is an alignment result, the global optimum must be included in the alignment result.
  • The results include all alignment which is not overlapped with more optimal alignment.

Aims

SigAlign is appropriate for the task of

  • quickly picking out similar alignments, rather than quantifying similarity or finding global optimum to also receive results for alignment with low similarity.
  • defining boundaries of results clearly, so when describing a result, instead of saying "I used this algorithm", results have their own semantics.

Quick Start

For Rust developer

  • As a Rust library, SigAlign can take advantage of the most abundant features in Rust. SigAlign is a package registered in crate.io and can be added using cargo in the project directory: cargo add sigalign
  • Example for Quick Scratch
use sigalign::wrapper::{
    DefaultAligner,
    DefaultReference,
};

// (1) Build `Reference`
let fasta =
br#">target_1
ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
>target_2
TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC"#;
let reference = DefaultReference::from_fasta_bytes(fasta).unwrap();

// (2) Instantiate `Aligner`
let mut aligner = DefaultAligner::new(
    4,   // Mismatch penalty
    6,   // Gap-open penalty
    2,   // Gap-extend penalty
    50,  // Minimum aligned length
    0.2, // Maximum penalty per length
).unwrap();

// (3) Perform alignment
let query = b"CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA";
let result = aligner.align_query(&reference, query).unwrap();
println!("{:#?}", result);

For Python developer

  • If you're a Python developer, you can make use of the Python bindings for SigAlign. You can use the pip the python package manager to install the package: pip install sigalign
  • Here is a quick start example:
from sigalign import Reference, Aligner

# (1) Construct `Reference`
reference = Reference.from_fasta_file("./YOUR_REFERENCE.fa")

# (2) Initialize `Aligner`
aligner = Aligner(4, 6, 2, 50, 0.2)

# (3) Execute Alignment
query = "CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA"
results = aligner.align_query(reference, query)

# (4) Display Results
for target_result in results:
    print(f"# Target index: {target_result.index}")
    for idx, alignment in enumerate(target_result.alignments):
        print(f"  - Result: {idx+1}")
        print(f"    - Penalty: {alignment.penalty}")
        print(f"    - Length: {alignment.length}")
        print(f"    - Query position: {alignment.query_position}")
        print(f"    - Target position: {alignment.target_position}")
  • For a detailed guide on how to use SigAlign in Python including a more comprehensive tutorial, please refer to the sigalign-py subdirectory README.

For Web developer

  • SigAlign offers a WebAssembly (WASM) build, opening up the potential for web-based applications. While it is not currently available through package managers such as npm, plans for web support are in the pipeline.
  • An exemplary WASM implementation can be found within the example directory. Below is a TypeScript example showcasing SigAlign's application via this WASM wrapper:
import init, { Reference, Aligner, type AlignmentResult } from '../wasm/sigalign_demo_wasm';

async function run() {
    await init();

    // (1) Construct `Reference`
    const fasta: string = `>target_1
ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
>target_2
TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC`;
    
    const reference: Reference = await Reference.build(fasta);
    
    // (2) Initialize `Aligner`
    const aligner: Aligner = new Aligner(
        4,    // Mismatch penalty
        6,    // Gap-open penalty
        2,    // Gap-extend penalty
        50,   // Minimum aligned length
        0.2,  // Maximum penalty per length
    );

    // (3) Execute Alignment
    const query: string = "CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA";
    const result: AlignmentResult = await aligner.alignment(query, reference);

    // (4) Parse and Display Results
    const parsedJsonObj = JSON.parse(result.to_json());
    console.log(parsedJsonObj);
}

run();
  • To gain further insight into web-based implementation of SigAlign, visit the SigAlign tour page. This page utilizes the WASM wrapper exemplified above.

License

SigAlign is released under the MIT License. Please refer to the LICENSE file in the repository for the full text.