<div align="center">
<h1><code>SigAlign</code></h1>
<p>
A <b>Si</b>milarity-<b>G</b>uided <b>Align</b>ment Algorithm
</p>
<p>
<a href="https://github.com/baku4/sigalign/" target="_blank"><img alt="License" src="https://img.shields.io/github/license/baku4/sigalign?style=flat-square"></a>
<a href="https://crates.io/crates/sigalign/" target="_blank"><img alt="Crates.io" src="https://img.shields.io/crates/v/sigalign.svg?style=flat-square"></a>
<a href="https://docs.rs/sigalign/latest/"><img src="https://img.shields.io/badge/docs-latest-blue.svg?style=flat-square" alt="docs.rs docs" /></a>
<a href="https://pypi.org/project/sigalign/" target="_blank"><img alt="PyPI" src="https://img.shields.io/pypi/v/sigalign?style=flat-square"></a>
</p>
</div>
## Key Features
### Simplified Parameters
- **Gap-Affine Penalties:** SigAlign incorporates a gap-affine penalty-based scoring scheme that promotes continuous gaps to reflect the complexity of biological sequences. The gap-affine penalty system is composed of:
1. Mismatch Penalty
2. Gap-Open Penalty
3. Gap-Extend Penalty
- **Similarity Cutoffs:** Defining a clear boundary for alignment results, SigAlign uses two key criteria:
1. Minimum Length (ML)
2. Maximum Penalty per Length (MPL)
### Clear Boundary of Results
- If there is no alignment result, the global optimum does not satisfy the cutoff.
- If there is an alignment result, the global optimum must be included in the alignment result.
- The results include all alignment which is not overlapped with more optimal alignment.
## Aims
SigAlign is appropriate for the task of
- quickly picking out similar alignments, rather than quantifying similarity or finding global optimum to also receive results for alignment with low similarity.
- defining boundaries of results clearly, so when describing a result, instead of saying "I used this algorithm", results have their own semantics.
## Quick Start
### For `Rust` developer
- As a Rust library, SigAlign can take advantage of the most abundant features in Rust. SigAlign is a package registered in `crate.io` and can be added using `cargo` in the project directory:
`cargo add sigalign`
- Example for Quick Scratch
```rust
use sigalign::wrapper::{
DefaultAligner,
DefaultReference,
};
let fasta =
br#">target_1
ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
>target_2
TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC"#;
let reference = DefaultReference::from_fasta_bytes(fasta).unwrap();
let mut aligner = DefaultAligner::new(
4, 6, 2, 50, 0.2, ).unwrap();
let query = b"CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA";
let result = aligner.align_query(&reference, query).unwrap();
println!("{:#?}", result);
```
- The detailed features and usage are in API documentation of crate (https://docs.rs/sigalign/).
### For `Python` developer
- If you're a Python developer, you can make use of the Python bindings for SigAlign. You can use the `pip` the python package manager to install the package:
`pip install sigalign`
- Here is a quick start example:
```python
from sigalign import Reference, Aligner
reference = Reference.from_fasta_file("./YOUR_REFERENCE.fa")
aligner = Aligner(4, 6, 2, 50, 0.2)
query = "CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA"
results = aligner.align_query(reference, query)
for target_result in results:
print(f"# Target index: {target_result.index}")
for idx, alignment in enumerate(target_result.alignments):
print(f" - Result: {idx+1}")
print(f" - Penalty: {alignment.penalty}")
print(f" - Length: {alignment.length}")
print(f" - Query position: {alignment.query_position}")
print(f" - Target position: {alignment.target_position}")
```
- For a detailed guide on how to use SigAlign in Python including a more comprehensive tutorial, please refer to the `sigalign-py` subdirectory [README](https://github.com/baku4/sigalign/tree/main/sigalign-py/README.md).
### For `Web` developer
- SigAlign offers a WebAssembly (WASM) build, opening up the potential for web-based applications. While it is not currently available through package managers such as `npm`, plans for web support are in the pipeline.
- An exemplary WASM implementation can be found within the `example` directory. Below is a TypeScript example showcasing SigAlign's application via this WASM wrapper:
```ts
import init, { Reference, Aligner, type AlignmentResult } from '../wasm/sigalign_demo_wasm';
async function run() {
await init();
// (1) Construct `Reference`
const fasta: string = `>target_1
ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
>target_2
TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC`;
const reference: Reference = await Reference.build(fasta);
// (2) Initialize `Aligner`
const aligner: Aligner = new Aligner(
4, // Mismatch penalty
6, // Gap-open penalty
2, // Gap-extend penalty
50, // Minimum aligned length
0.2, // Maximum penalty per length
);
// (3) Execute Alignment
const query: string = "CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA";
const result: AlignmentResult = await aligner.alignment(query, reference);
// (4) Parse and Display Results
const parsedJsonObj = JSON.parse(result.to_json());
console.log(parsedJsonObj);
}
run();
```
- To gain further insight into web-based implementation of SigAlign, visit the SigAlign [tour page](https://baku4.github.io/sigalign/). This page utilizes the WASM wrapper exemplified above.
## Compiler Version Compatibility Issue
As of the latest updates, it appears that our library has encountered a compilation error on Rust versions newer than `rustc` 1.69.0. The functions within the `sigalign::algorithm::anchor::unsafe_masking` module are not being compiled with the latest compiler. Preliminary investigation suggests that this issue stems from a compiler error.
We are actively working to address this and ensure compatibility with the latest Rust compiler. In the meantime, to resolve this issue, we recommend manually setting the `rustc` version to 1.69.0:
```bash
rustup override set 1.69.0
```
## License
SigAlign is released under the MIT License. Please refer to the [LICENSE](https://github.com/baku4/sigalign/blob/main/LICENSE) file in the repository for the full text.