PLACE-CARE

Read documentation in other languages:

• 中文

PLACE-CARE

placecare is a fast tool for searching cis-acting elements using the PLACE database.

With placecare, you can:

1. Upload sequence files to search for cis-acting elements.

2. Quickly retrieve relevant information through PLACE database's id and ac (Data comes from the place.seq file provided by the official PLACE website)

Installation

You can now use placecare (via Wasm) by visiting the website.

If your computer has the Rust toolchain, you can install our command-line program with the following command:

cargo install placecare

If you don't have the Rust toolchain installed, you can also download our compiled binary files directly from GitHub's Release:

• Release

Usage

First, you need to use it like this:

The core functionality of placehere is written in the place_search module, I/O operations are written in the io module, and the place_desc module describes the PLACE data.

Query Elements

We provide multiple ways to input sequences, as shown below:

use placehere::io::RecordDesc;

let input = vec![RecordDesc::new("Gh_01", "TTATAGACTCGATGGCCGCGCGG")];
let input = RecordDesc::from_file("./input.fasta");
let input = RecordDesc::from_string("\
>Gh_01
ATATCCGGATGGCATGCTGATC
");
let input = RecordDesc::from_records(bio::io::fasta::Reader::new("./input.fasta"));

let mut f = File::open("input.txt").unwrap();
let input = RecordDesc::from_reader(f);

Then we can search:

use placecare::place_search::Search;

// Search for a single element
let result = Search::search_element(input).unwrap();

// Search for multiple elements
let result = Search::search_elements(input).unwrap();

You can view the definitions in the place_desc module to understand the output information.

Tips

IUPAC Ambiguous Bases

The PLACE database uses IUPAC ambiguous base symbols (Wikipedia) to represent multiple possible bases.

License

placecare is an open-source project under the MIT license. You are free to use, modify, and distribute this software, but please retain the original author's copyright notice and license information.