1 3 seq 2 1 - 1 for a ONEfile, of type seq, ONEcode version 2.1
. - the next two lines are provenance lines, giving the history of the file
! 4 5 seqio 3 1.0 24 ./seqconvert -1 small.fa 19 2023-07-18_17:39:10
! 4 7 ONEview 3 0.0 18 ONEview small.1seq 19 2023-07-21_11:00:56
. - the next two lines are the (very simple) schema for this file
. - one object type S holding DNA, and one data line I holding a text string
~ O S 1 3 DNA sequence: the DNA string
~ D I 1 6 STRING id: (optional) sequence identifier
. - the next set of lines hold stats about the file contents
. - # numbers of lines, length of longest list, total list length
# I 10
@ I 5
+ I 41
# S 10
@ S 72
+ S 577
. - finally we get the data
S 51 cttagtagcgatattagttaataaaggtaaattcaaatgcgagtggtagat
I 4 seq1
S 72 ctttaccctccgaggctcttatccaccagaaacttccgccggggtccaggactcttaacgttcttctgtaat
I 4 seq2
S 58 catattctgtcgtaaatgtagaagaaagtagtagacaactcagaacgatcagaacggt
I 4 seq3
S 42 ttttgagcgagagagaatgataagacctcgagggagcttgaa
I 4 seq4
S 55 tttaaatcaaaggccgaagtttttttaagcgacaaagcactttaatatcatatag
I 4 seq5
S 66 agagtgaatatcattaaactagacattcacgatagaaaattagttaattatttctctttccgagta
I 4 seq6
S 47 gctctgtataatgtttctgttttactgtgtttgggattatgctaagc
I 4 seq7
S 62 ccgagatctataacagtatcaaaaataaaaaacttttaataaaatattaaaattattgaaat
I 4 seq8
S 53 tagaagttgtttaataagttttattcacaatcgtttaatatttacacataaaa
I 4 seq9
S 71 acatttacatattgatgtaacactcctatagcctttgatgaccgaaaactttaatttttaatacgagagtt
I 5 seq10