lt-fm-index 0.7.1

FM-index using k-mer lookup table for exact pattern matching
/*!
# lt-fm-index

`LtFmIndex` is a Rust library for building and using a FM-index that contains a lookup table of the first *k-mer* of a pattern. This index can be used to (1) count the number of occurrences and (2) locate the positions of a pattern in an indexed text.

## Usage
[LtFmIndex] uses two generic types: [Position], [Block].
- [Position] is a type that represents the position of a character in the text.
    - [Position] uses [u32], [u64], [u128].
    - Small types are faster, but the maximum text length is restricted.
- [Block] is a type that represents the BWT's block of the index.
    - [Block] restricts the maximum count of the characters (detailed in [blocks]).
        - Small types are faster, but the maximum count of the characters is restricted.
    - [Block] uses [blocks::Vector] as inner vectors.
        - Currently, [blocks::Vector] is implemented for: u32, u64, u128.
        - The shorter the vector, the faster the algorithm, but the larger the struct.
### Example
```rust
use lt_fm_index::LtFmIndex;
use lt_fm_index::blocks::Block2; // `Block2` can index 3 types of characters.

// (1) Define characters to use
let characters_by_index: &[&[u8]] = &[
    &[b'A', b'a'], // 'A' and 'a' are treated as the same
    &[b'C', b'c'], // 'C' and 'c' are treated as the same
    &[b'G', b'g'], // 'G' and 'g' are treated as the same
];
// Alternatively, you can use this simpler syntax:
let characters_by_index: &[&[u8]] = &[
    b"Aa", b"Cc", b"Gg"
];

// (2) Build index
let text = b"CTCCGTACACCTGTTTCGTATCGGAXXYYZZ".to_vec();
let lt_fm_index= LtFmIndex::<u32, Block2<u128>>::build(
    text,
    characters_by_index,
    2,
    4,
).unwrap();

// (3) Match with pattern
let pattern = b"TA";
//   - count
let count = lt_fm_index.count(pattern);
assert_eq!(count, 2);
//   - locate
let mut locations = lt_fm_index.locate(pattern);
locations.sort();  // The locations may not be in order.
assert_eq!(locations, vec![5,18]);
// All unindexed characters are treated as the same character.
// In the text, X, Y, and Z can match any other unindexed character
let mut locations = lt_fm_index.locate(b"UNDEF");
locations.sort();
// Using the b"XXXXX", b"YYYYY", or b"!@#$%" gives the same result.
assert_eq!(locations, vec![25,26]);

// (4) Save and load
let mut buffer = Vec::new();
lt_fm_index.save_to(&mut buffer).unwrap();
let loaded = LtFmIndex::load_from(&buffer[..]).unwrap();
assert_eq!(lt_fm_index, loaded);
```
*/

mod core;
pub use crate::core::{
    Position,
    errors::BuildError,
};
mod algorithm;
pub use algorithm::{
    LtFmIndex,
    Block,
    blocks,
};

#[cfg(test)]
mod tests;