<div class="title-block" style="text-align: center;" align="center">
# `bio-seq`
### Bit-packed and well-typed biological sequences
</div>
```rust
use bio_seq::{dna, Seq, FromStr};
use bio_seq::codec::{dna::Dna, ReverseComplement};
let seq = dna!("ATACGATCGATCGATCGATCCGT");
// iterate over the 8-mers of the reverse complement
for kmer in seq.revcomp().kmers::<8>() {
println!("{}", kmer);
}
```
The IUPAC nucleotide ambiguity codes naturally encode a set of bases for each position:
```rust
let seq = iupac!("AGCTNNCAGTCGACGTATGTA");
let pattern = Seq::<Iupac>::from_str("AYG").unwrap();
for slice in seq.windows(pattern.len()) {
if pattern.contains(slice) {
println!("{} matches pattern", slice);
}
}
```
The primary design goal of this crate is to make translating between biological sequence types safe and convenient:
```rust
// debruijn sequence of order 3
let seq: Seq<Dna> =
dna!("AATTTGTGGGTTCGTCTGCGGCTCCGCCCTTAGTACTATGAGGACGATCAGCACCATAAGAACAAA");
let aminos: Seq<Amino> = Seq::from_vec(seq.kmers().map(|kmer| kmer.into()).collect());
assert_eq!(
aminos,
amino!("NIFLCVWGGVFSRVSLCARGALSPRAPPLL*SVYTLYM*ERGDTRDISQSAHTPHI*KRENTQK")
);
```
## Contents
* [Codec](#codecs): Coding/Decoding schemes for the characters of a biological sequence
* [Seq](#sequences): A sequence of encoded characters
* [Kmer](#kmers): A fixed size sequence of length `K`
* [Derivable codecs](#derivable-codecs): This crate offers utilities for defining your own bit-level encodings
* [Safe conversion](#sequence-conversion) between sequences
## Codecs
The `Codec` trait describes the coding/decoding process for the characters of a biological sequence. This trait can be derived procedurally. There are three built-in codecs:
### `codec::Dna`
Using the lexicographically ordered 2-bit representation
### `codec::Iupac`
IUPAC nucleotide ambiguity codes are represented with 4 bits. This supports membership resolution with bitwise operations. Logical `or` is the union:
```rust
assert_eq!(iupac!("AS-GYTNA") | iupac!("ANTGCAT-"), iupac!("ANTGYWNA"));
```
Logical `and` is the intersection of two iupac sequences:
```rust
assert_eq!(iupac!("ACGTSWKM") & iupac!("WKMSTNNA"), iupac!("A----WKA"));
```
### `codec::Amino`
Amino acid sequences are represented with 6 bits. The representation of amino acids is designed to be easy to coerce from sequences of 2-bit encoded DNA.
## Sequences
Strings of encoded biological characters are packed into `Seq`s. Slicing, chunking, and windowing return `SeqSlice`s. `Seq<A: Codec>`/`&SeqSlice<A: Codec>` are analogous to `String`/`&str`.
## Kmers
kmers are sequences with a fixed size that can fit into a register. these are implemented with const generics.
### Dense encodings
For dense encodings, a lookup table can be populated and indexed in constant time with the `usize` representation:
```rust
fn kmer_histogram<C: Codec, const K: usize>(seq: &SeqSlice<C>) -> Vec<usize> {
// For dna::Dna our histogram will need 4^4
// bins to count every possible 4-mer.
let mut histo = vec![0; 1 << (C::WIDTH * K as u8)];
for kmer in seq.kmers::<K>() {
histo[usize::from(kmer)] += 1;
}
histo
}
```
This example builds a histogram of kmer occurences
## Sketching
### Hashing
The `Hash` trait is implemented for Kmers
### Canonical Kmers
Depending on the application, it may be permissible to superimpose the forward and reverse complements of a kmer:
```rust
k = kmer!("ACGTGACGT");
let canonical = k ^ k.revcomp(); // TODO: implement ReverseComplement for Kmer
```
### Kmer minimisers
The 2-bit representation of nucleotides is ordered `A < C < G < T`. The ordering of kmers reverses the order of bases:
`AAAA < CAAA < ... < TTTT`
but
`CAAA < AAAC`
With this ordering in mind, minimisers are automatically implemented:
```rust
fn minimise(seq: Seq<Dna>) -> Option<Kmer::<Dna, 8>> {
seq.kmers().min()
}
```
### Example: Hashing minimiser of canonical Kmers
```rust
...
}
```
## Derivable codecs
Sequence coding/decoding is derived from the variant names and discriminants of enum types:
```rust
use bio_seq_derive::Codec;
use bio_seq::codec::{Codec, ParseBioErr};
#[derive(Clone, Copy, Debug, PartialEq, Codec)]
#[width = 2]
#[repr(u8)]
pub enum Dna {
A = 0b00,
C = 0b01,
G = 0b10,
T = 0b11,
}
impl From<Dna> for u8 {
fn from(dna: Dna) -> Self {
dna as u8
}
}
```
The `width` attribute specifies how many bits the encoding requires per symbol. The maximum supported is 8.
Kmers are stored as `usize`s with the least significant bit first.
## Sequence conversions
`Iupac` from `Dna`; `Seq<Iupac>` from `Seq<Dna>`
`Amino` from `Kmer<3>`; `Seq<Amino>` from `Seq<Dna>`
* Sequence length not a multiple of 3 is an error
`Seq<Iupac>` from `Amino`; `Seq<Iupac>` from `Seq<Amino>` (TODO)
`Vec<Seq<Dna>>` from `Seq<Iupac>`: A sequence of IUPAC codes can generate a list of DNA sequences of the same length. (TODO)