pub struct Kmer<C: Codec, const K: usize, S: KmerStorage = usize> { /* private fields */ }Expand description
By default k-mers are backed by usize and Codec::BITS * K must be <= 64 on 64-bit platforms
ⓘ
// 40 * 2 bits does not fit in a usize
let kmer: Kmer<Dna, 40> = "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT".parse().unwrap();// ..but 80 bits does fit into a u128
let kmer: Kmer<Dna, 40, u128> = "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT".parse().unwrap();
assert_eq!(kmer.len(), 40);Implementations§
Source§impl<A: Codec, const K: usize, S: KmerStorage> Kmer<A, K, S>
impl<A: Codec, const K: usize, S: KmerStorage> Kmer<A, K, S>
pub const fn len(&self) -> usize
pub const fn is_empty(&self) -> bool
pub fn rotated_left(&self, n: u32) -> Self
pub fn rotated_right(&self, n: u32) -> Self
Sourcepub fn pushr(self, base: A) -> Self
pub fn pushr(self, base: A) -> Self
Shift bases to the right and push a base onto the end.
use bio_seq::prelude::*;
use bio_seq::codec::dna::Dna;
let k = kmer!("ACGAT");
assert_eq!(k.pushr(Dna::T).to_string(), "CGATT");Sourcepub fn unsafe_from_seqslice(seq: &SeqSlice<A>) -> Self
pub fn unsafe_from_seqslice(seq: &SeqSlice<A>) -> Self
Create Kmer from sequence without checking length
Methods from Deref<Target = SeqSlice<A>>§
pub fn chain( self: &'a SeqSlice<A>, second: &'a SeqSlice<A>, ) -> Chain<SeqIter<'a, A>, SeqIter<'a, A>> ⓘ
pub fn iter(&'a self) -> SeqIter<'a, A> ⓘ
Sourcepub fn kmers<const K: usize>(&self) -> KmerIter<'_, A, K> ⓘ
pub fn kmers<const K: usize>(&self) -> KmerIter<'_, A, K> ⓘ
Iterate over sliding windows of length K
Sourcepub fn windows(&self, width: usize) -> SeqChunks<'_, A> ⓘ
pub fn windows(&self, width: usize) -> SeqChunks<'_, A> ⓘ
Iterate over the sequence in overlapping windows of a specified width
use bio_seq::prelude::*;
let seq: Seq<Dna> = "ACTGATCG".try_into().unwrap();
let windows: Vec<String> = seq.windows(3).map(String::from).collect();
assert_eq!(windows, vec!["ACT", "CTG", "TGA", "GAT", "ATC", "TCG"]);§Panics
Panics if width is 0.
Sourcepub fn chunks(&self, width: usize) -> SeqChunks<'_, A> ⓘ
pub fn chunks(&self, width: usize) -> SeqChunks<'_, A> ⓘ
Iterate over the sequence in non-overlapping chunks of a specified width
The last incomplete chunk will be excluded if the sequence length is not divisible by the specified width.
use bio_seq::prelude::*;
let seq: Seq<Dna> = "ACTGATCG".try_into().unwrap();
let chunks: Vec<Seq<Dna>> = seq.chunks(3).collect();
assert_eq!(chunks, vec![dna!("ACT"), dna!("GAT")]);§Panics
Panics if width is 0.
pub fn len(&self) -> usize
Sourcepub fn get(&self, i: usize) -> Option<A>
pub fn get(&self, i: usize) -> Option<A>
Get the ith element of a Seq. Returns None if index out of range.
pub fn is_empty(&self) -> bool
Trait Implementations§
Source§impl<const K: usize, S: KmerStorage> Complement for Kmer<Dna, K, S>
impl<const K: usize, S: KmerStorage> Complement for Kmer<Dna, K, S>
Source§impl<const K: usize, S: KmerStorage> ComplementMut for Kmer<Dna, K, S>
impl<const K: usize, S: KmerStorage> ComplementMut for Kmer<Dna, K, S>
impl<C: Copy + Codec, const K: usize, S: Copy + KmerStorage> Copy for Kmer<C, K, S>
Source§impl<'de, C: Codec, const K: usize, S> Deserialize<'de> for Kmer<C, K, S>where
S: Deserialize<'de> + KmerStorage,
impl<'de, C: Codec, const K: usize, S> Deserialize<'de> for Kmer<C, K, S>where
S: Deserialize<'de> + KmerStorage,
Source§fn deserialize<__D>(__deserializer: __D) -> Result<Self, __D::Error>where
__D: Deserializer<'de>,
fn deserialize<__D>(__deserializer: __D) -> Result<Self, __D::Error>where
__D: Deserializer<'de>,
Deserialize this value from the given Serde deserializer. Read more
impl<C: Eq + Codec, const K: usize, S: Eq + KmerStorage> Eq for Kmer<C, K, S>
Source§impl<A: Codec, const K: usize, S: KmerStorage> Hash for Kmer<A, K, S>
use bio_seq::prelude::*;
use std::hash::{Hash, Hasher, DefaultHasher};
let mut hasher1 = DefaultHasher::new();
kmer!("AAA").hash(&mut hasher1);
let hash1 = hasher1.finish();
let mut hasher2 = DefaultHasher::new();
kmer!("AAAA").hash(&mut hasher2);
let hash2 = hasher2.finish();
assert_ne!(hash1, hash2);
impl<A: Codec, const K: usize, S: KmerStorage> Hash for Kmer<A, K, S>
use bio_seq::prelude::*;
use std::hash::{Hash, Hasher, DefaultHasher};
let mut hasher1 = DefaultHasher::new();
kmer!("AAA").hash(&mut hasher1);
let hash1 = hasher1.finish();
let mut hasher2 = DefaultHasher::new();
kmer!("AAAA").hash(&mut hasher2);
let hash2 = hasher2.finish();
assert_ne!(hash1, hash2);Source§impl<C: Ord + Codec, const K: usize, S: Ord + KmerStorage> Ord for Kmer<C, K, S>
impl<C: Ord + Codec, const K: usize, S: Ord + KmerStorage> Ord for Kmer<C, K, S>
1.21.0 (const: unstable) · Source§fn max(self, other: Self) -> Selfwhere
Self: Sized,
fn max(self, other: Self) -> Selfwhere
Self: Sized,
Compares and returns the maximum of two values. Read more
1.21.0 (const: unstable) · Source§fn min(self, other: Self) -> Selfwhere
Self: Sized,
fn min(self, other: Self) -> Selfwhere
Self: Sized,
Compares and returns the minimum of two values. Read more
Source§impl<C: PartialEq + Codec, const K: usize, S: PartialEq + KmerStorage> PartialEq for Kmer<C, K, S>
impl<C: PartialEq + Codec, const K: usize, S: PartialEq + KmerStorage> PartialEq for Kmer<C, K, S>
Source§impl<A: Codec, const K: usize, S: KmerStorage> PartialEq<&SeqArray<A, K, 1>> for Kmer<A, K, S>
impl<A: Codec, const K: usize, S: KmerStorage> PartialEq<&SeqArray<A, K, 1>> for Kmer<A, K, S>
Source§impl<A: Codec, const K: usize, S: KmerStorage> PartialEq<SeqArray<A, K, 1>> for Kmer<A, K, S>
impl<A: Codec, const K: usize, S: KmerStorage> PartialEq<SeqArray<A, K, 1>> for Kmer<A, K, S>
Source§impl<C: PartialOrd + Codec, const K: usize, S: PartialOrd + KmerStorage> PartialOrd for Kmer<C, K, S>
impl<C: PartialOrd + Codec, const K: usize, S: PartialOrd + KmerStorage> PartialOrd for Kmer<C, K, S>
Source§impl<const K: usize> ReverseComplement for Kmer<Dna, K, usize>
impl<const K: usize> ReverseComplement for Kmer<Dna, K, usize>
fn to_revcomp(&self) -> <Self as ToOwned>::Owned
Source§impl<A: Codec, const K: usize, S: KmerStorage> ReverseMut for Kmer<A, K, S>
impl<A: Codec, const K: usize, S: KmerStorage> ReverseMut for Kmer<A, K, S>
Source§impl<C: Codec, const K: usize, S> Serialize for Kmer<C, K, S>where
S: Serialize + KmerStorage,
impl<C: Codec, const K: usize, S> Serialize for Kmer<C, K, S>where
S: Serialize + KmerStorage,
impl<C: PartialEq + Codec, const K: usize, S: PartialEq + KmerStorage> StructuralPartialEq for Kmer<C, K, S>
Auto Trait Implementations§
impl<C, const K: usize, S> Freeze for Kmer<C, K, S>
impl<C, const K: usize, S> RefUnwindSafe for Kmer<C, K, S>
impl<C, const K: usize, S> Send for Kmer<C, K, S>
impl<C, const K: usize, S> Sync for Kmer<C, K, S>
impl<C, const K: usize, S> Unpin for Kmer<C, K, S>
impl<C, const K: usize, S> UnsafeUnpin for Kmer<C, K, S>
impl<C, const K: usize, S> UnwindSafe for Kmer<C, K, S>
Blanket Implementations§
Source§impl<T> BorrowMut<T> for Twhere
T: ?Sized,
impl<T> BorrowMut<T> for Twhere
T: ?Sized,
Source§fn borrow_mut(&mut self) -> &mut T
fn borrow_mut(&mut self) -> &mut T
Mutably borrows from an owned value. Read more
Source§impl<T> CloneToUninit for Twhere
T: Clone,
impl<T> CloneToUninit for Twhere
T: Clone,
impl<T> DeserializeOwned for Twhere
T: for<'de> Deserialize<'de>,
Source§impl<T> FmtForward for T
impl<T> FmtForward for T
Source§fn fmt_binary(self) -> FmtBinary<Self>where
Self: Binary,
fn fmt_binary(self) -> FmtBinary<Self>where
Self: Binary,
Causes
self to use its Binary implementation when Debug-formatted.Source§fn fmt_display(self) -> FmtDisplay<Self>where
Self: Display,
fn fmt_display(self) -> FmtDisplay<Self>where
Self: Display,
Causes
self to use its Display implementation when
Debug-formatted.Source§fn fmt_lower_exp(self) -> FmtLowerExp<Self>where
Self: LowerExp,
fn fmt_lower_exp(self) -> FmtLowerExp<Self>where
Self: LowerExp,
Causes
self to use its LowerExp implementation when
Debug-formatted.Source§fn fmt_lower_hex(self) -> FmtLowerHex<Self>where
Self: LowerHex,
fn fmt_lower_hex(self) -> FmtLowerHex<Self>where
Self: LowerHex,
Causes
self to use its LowerHex implementation when
Debug-formatted.Source§fn fmt_octal(self) -> FmtOctal<Self>where
Self: Octal,
fn fmt_octal(self) -> FmtOctal<Self>where
Self: Octal,
Causes
self to use its Octal implementation when Debug-formatted.Source§fn fmt_pointer(self) -> FmtPointer<Self>where
Self: Pointer,
fn fmt_pointer(self) -> FmtPointer<Self>where
Self: Pointer,
Causes
self to use its Pointer implementation when
Debug-formatted.Source§fn fmt_upper_exp(self) -> FmtUpperExp<Self>where
Self: UpperExp,
fn fmt_upper_exp(self) -> FmtUpperExp<Self>where
Self: UpperExp,
Causes
self to use its UpperExp implementation when
Debug-formatted.Source§fn fmt_upper_hex(self) -> FmtUpperHex<Self>where
Self: UpperHex,
fn fmt_upper_hex(self) -> FmtUpperHex<Self>where
Self: UpperHex,
Causes
self to use its UpperHex implementation when
Debug-formatted.Source§impl<T> Pipe for Twhere
T: ?Sized,
impl<T> Pipe for Twhere
T: ?Sized,
Source§fn pipe<R>(self, func: impl FnOnce(Self) -> R) -> Rwhere
Self: Sized,
fn pipe<R>(self, func: impl FnOnce(Self) -> R) -> Rwhere
Self: Sized,
Pipes by value. This is generally the method you want to use. Read more
Source§fn pipe_ref<'a, R>(&'a self, func: impl FnOnce(&'a Self) -> R) -> Rwhere
R: 'a,
fn pipe_ref<'a, R>(&'a self, func: impl FnOnce(&'a Self) -> R) -> Rwhere
R: 'a,
Borrows
self and passes that borrow into the pipe function. Read moreSource§fn pipe_ref_mut<'a, R>(&'a mut self, func: impl FnOnce(&'a mut Self) -> R) -> Rwhere
R: 'a,
fn pipe_ref_mut<'a, R>(&'a mut self, func: impl FnOnce(&'a mut Self) -> R) -> Rwhere
R: 'a,
Mutably borrows
self and passes that borrow into the pipe function. Read moreSource§fn pipe_borrow<'a, B, R>(&'a self, func: impl FnOnce(&'a B) -> R) -> R
fn pipe_borrow<'a, B, R>(&'a self, func: impl FnOnce(&'a B) -> R) -> R
Source§fn pipe_borrow_mut<'a, B, R>(
&'a mut self,
func: impl FnOnce(&'a mut B) -> R,
) -> R
fn pipe_borrow_mut<'a, B, R>( &'a mut self, func: impl FnOnce(&'a mut B) -> R, ) -> R
Source§fn pipe_as_ref<'a, U, R>(&'a self, func: impl FnOnce(&'a U) -> R) -> R
fn pipe_as_ref<'a, U, R>(&'a self, func: impl FnOnce(&'a U) -> R) -> R
Borrows
self, then passes self.as_ref() into the pipe function.Source§fn pipe_as_mut<'a, U, R>(&'a mut self, func: impl FnOnce(&'a mut U) -> R) -> R
fn pipe_as_mut<'a, U, R>(&'a mut self, func: impl FnOnce(&'a mut U) -> R) -> R
Mutably borrows
self, then passes self.as_mut() into the pipe
function.Source§fn pipe_deref<'a, T, R>(&'a self, func: impl FnOnce(&'a T) -> R) -> R
fn pipe_deref<'a, T, R>(&'a self, func: impl FnOnce(&'a T) -> R) -> R
Borrows
self, then passes self.deref() into the pipe function.Source§impl<T> Tap for T
impl<T> Tap for T
Source§fn tap_borrow<B>(self, func: impl FnOnce(&B)) -> Self
fn tap_borrow<B>(self, func: impl FnOnce(&B)) -> Self
Immutable access to the
Borrow<B> of a value. Read moreSource§fn tap_borrow_mut<B>(self, func: impl FnOnce(&mut B)) -> Self
fn tap_borrow_mut<B>(self, func: impl FnOnce(&mut B)) -> Self
Mutable access to the
BorrowMut<B> of a value. Read moreSource§fn tap_ref<R>(self, func: impl FnOnce(&R)) -> Self
fn tap_ref<R>(self, func: impl FnOnce(&R)) -> Self
Immutable access to the
AsRef<R> view of a value. Read moreSource§fn tap_ref_mut<R>(self, func: impl FnOnce(&mut R)) -> Self
fn tap_ref_mut<R>(self, func: impl FnOnce(&mut R)) -> Self
Mutable access to the
AsMut<R> view of a value. Read moreSource§fn tap_deref<T>(self, func: impl FnOnce(&T)) -> Self
fn tap_deref<T>(self, func: impl FnOnce(&T)) -> Self
Immutable access to the
Deref::Target of a value. Read moreSource§fn tap_deref_mut<T>(self, func: impl FnOnce(&mut T)) -> Self
fn tap_deref_mut<T>(self, func: impl FnOnce(&mut T)) -> Self
Mutable access to the
Deref::Target of a value. Read moreSource§fn tap_dbg(self, func: impl FnOnce(&Self)) -> Self
fn tap_dbg(self, func: impl FnOnce(&Self)) -> Self
Calls
.tap() only in debug builds, and is erased in release builds.Source§fn tap_mut_dbg(self, func: impl FnOnce(&mut Self)) -> Self
fn tap_mut_dbg(self, func: impl FnOnce(&mut Self)) -> Self
Calls
.tap_mut() only in debug builds, and is erased in release
builds.Source§fn tap_borrow_dbg<B>(self, func: impl FnOnce(&B)) -> Self
fn tap_borrow_dbg<B>(self, func: impl FnOnce(&B)) -> Self
Calls
.tap_borrow() only in debug builds, and is erased in release
builds.Source§fn tap_borrow_mut_dbg<B>(self, func: impl FnOnce(&mut B)) -> Self
fn tap_borrow_mut_dbg<B>(self, func: impl FnOnce(&mut B)) -> Self
Calls
.tap_borrow_mut() only in debug builds, and is erased in release
builds.Source§fn tap_ref_dbg<R>(self, func: impl FnOnce(&R)) -> Self
fn tap_ref_dbg<R>(self, func: impl FnOnce(&R)) -> Self
Calls
.tap_ref() only in debug builds, and is erased in release
builds.Source§fn tap_ref_mut_dbg<R>(self, func: impl FnOnce(&mut R)) -> Self
fn tap_ref_mut_dbg<R>(self, func: impl FnOnce(&mut R)) -> Self
Calls
.tap_ref_mut() only in debug builds, and is erased in release
builds.Source§fn tap_deref_dbg<T>(self, func: impl FnOnce(&T)) -> Self
fn tap_deref_dbg<T>(self, func: impl FnOnce(&T)) -> Self
Calls
.tap_deref() only in debug builds, and is erased in release
builds.