Struct umgap::commands::fastq2fasta::FastqToFasta

pub struct FastqToFasta {
    pub input: Vec<PathBuf>,
}

Interleaves FASTQ files into a FASTA stream

The umgap fastq2fasta command takes one or more FASTQ files and interleaves them into a single FASTA file.

The FASTQ input files are given as command line arguments. In order, a single record is taken from each of these files, and the record header and sequence are written to standard output in FASTA format, dropping the quality scores, until any of the files runs out or records.

This command is generally used to combine two paired-end FASTQ files into a single FASTA file.

$ cat input_1.fq
@record1/1
GATAGCCGTCGAGCGTCCCGACATCCATATACAGCTCGCCGCAGTGCGTCGCCCGCACGGCATCGCGCGCCGCGATGTACGCATTCAACCAGCGTCCGAG
+
AADGGGG<GI@IIKJKKKKH4EIJCHJ9:IJHKIKDIKDKGDJD@C@<>KD=;FEA:DA=I$EEED$>C@1EDE?D:CEAC;CDE:E$D$=D$EAD?AEE
@record2/1
CCCAGGTCCCCGGCATCGTCGCGGCCTCGCCCATGATCCAGCTCCACGACCAGATCCCCGTTCCCGGCGGTAAAGAGCGCGGCGTGCTCATCCTCGGAGT
+
ADDEEG@GIGIIHKCJKH@HHGKHHKHKKJJBA.GFIGK(IHKKEKECBEEEEDIKC@H<EDBJDEA36;6EE$E:G6C=E$E@CE?EE9FEE?E:F$?$
$ cat input_2.fq
@record1/2
CATTGTTCGCTACTTTGCGGAGCGCAATTATGCCGCGGAGATCTTCTACGTGGTGCAGCAGAAGCTGGCGGGCTGGTGCGATGCGTTGTATCGGCCCGAG
+
DDDEGGG?HIHIIKHK?@2KBHGDCJKI(JEJJKKHKKHBHKKFICEICECCFFEICCCC$E6ED$?CEEDDED$DEDCFFECEEEEFB$CCEC$6C=CA
@record2/2
GGACACGCTCTCAGGACGATGGCGCGATTGCAGGACTTGCTGGATCTCCTCCGTCGCCAAGGGGACGCGCTCGGAGTGGCTCATGGAGCAGACGAGTTCT
+
AADGGGEGIIIHIJKGCK<KD:KKHI?HIHHJKFJEKKJIGE$CKHE$EE$FEEEI=EAE8EAIKFBEE$EADEEDB$DEEDE=?B6C$C$6$A$$=BEE
$ umgap fastq2fasta input_1.fq input_2.fq
>record1/1
GATAGCCGTCGAGCGTCCCGACATCCATATACAGCTCGCCGCAGTGCGTCGCCCGCACGGCATCGCGCGCCGCGATGTACGCATTCAACCAGCGTCCGAG
>record1/2
CATTGTTCGCTACTTTGCGGAGCGCAATTATGCCGCGGAGATCTTCTACGTGGTGCAGCAGAAGCTGGCGGGCTGGTGCGATGCGTTGTATCGGCCCGAG
>record2/1
CCCAGGTCCCCGGCATCGTCGCGGCCTCGCCCATGATCCAGCTCCACGACCAGATCCCCGTTCCCGGCGGTAAAGAGCGCGGCGTGCTCATCCTCGGAGT
>record2/2
GGACACGCTCTCAGGACGATGGCGCGATTGCAGGACTTGCTGGATCTCCTCCGTCGCCAAGGGGACGCGCTCGGAGTGGCTCATGGAGCAGACGAGTTCT

Fields

input: Vec<PathBuf>

The input files

Trait Implementations

impl Debug for FastqToFasta

fn fmt(&self, f: &mut Formatter<'_>) -> Result

Formats the value using the given formatter.

impl StructOpt for FastqToFasta

fn clap<'a, 'b>() -> App<'a, 'b>

Returns clap::App corresponding to the struct.

fn from_clap(matches: &ArgMatches<'_>) -> Self

Builds the struct from clap::ArgMatches. It’s guaranteed to succeed if matches originates from an App generated by StructOpt::clap called on the same type, otherwise it must panic.

fn from_args() -> Self

where Self: Sized,

Builds the struct from the command line arguments (std::env::args_os). Calls clap::Error::exit on failure, printing the error message and aborting the program.

fn from_args_safe() -> Result<Self, Error>

where Self: Sized,

Builds the struct from the command line arguments (std::env::args_os). Unlike StructOpt::from_args, returns clap::Error on failure instead of aborting the program, so calling .exit is up to you.

fn from_iter<I>(iter: I) -> Self

where Self: Sized, I: IntoIterator, <I as IntoIterator>::Item: Into<OsString> + Clone,

Gets the struct from any iterator such as a Vec of your making. Print the error message and quit the program in case of failure.

fn from_iter_safe<I>(iter: I) -> Result<Self, Error>

where Self: Sized, I: IntoIterator, <I as IntoIterator>::Item: Into<OsString> + Clone,

Gets the struct from any iterator such as a Vec of your making.