Expand description
§sshash-lib
Core library for SSHash-rs: a compressed k-mer dictionary based on sparse and skew hashing.
§Quick Start
use sshash_lib::{Dictionary, Kmer, KmerBits};
type Kmer31 = Kmer<31>;
fn main() -> Result<(), Box<dyn std::error::Error>> {
// Load a previously built index
let dict = Dictionary::load("index")?;
// Single k-mer lookup (returns position or INVALID_UINT64)
let kmer = Kmer31::from_string("ACGTACGTACGTACGTACGTACGTACGTACG")?;
let pos = dict.lookup::<31>(&kmer);
// Streaming queries over a sequence
let mut engine = dict.create_streaming_query::<31>();
Ok(())
}§Modules
| Module | Purpose |
|---|---|
dictionary | Load, save, lookup, and query k-mers |
builder | Index construction pipeline |
streaming_query | Efficient sequential k-mer processing |
kmer | Kmer<K> with const-generic sizing and bit-parallel ops |
minimizer | Minimizer extraction and iteration |
minimizers_control_map | MPHF-based minimizer→bucket mapping |
spectrum_preserving_string_set | SPSS: unitig storage and position lookup |
sparse_and_skew_index | Bucket dispatch (singleton / light / heavy) |
offsets | Elias-Fano encoded string boundary offsets |
§License
MIT
Re-exports§
pub use kmer::Kmer;pub use kmer::Kmer21;pub use kmer::Kmer31;pub use kmer::Kmer63;pub use kmer::KmerBits;pub use minimizer::MinimizerInfo;pub use minimizer::MinimizerIterator;pub use minimizers_control_map::MinimizersControlMap;pub use minimizers_control_map::MinimizersControlMapBuilder;pub use minimizers_control_map::BucketType;pub use streaming_query::LookupResult;pub use streaming_query::StreamingQuery;pub use dictionary::Dictionary;pub use builder::BuildConfiguration;pub use builder::CfSegData;pub use builder::DictionaryBuilder;pub use builder::parse_cf_seg;
Modules§
- builder
- Builder module for constructing SSHash dictionaries
- constants
- Constants and configuration for SSHash
- dictionary
- Dictionary - the main SSHash data structure
- encoding
- DNA nucleotide encoding
- hasher
- Deterministic hasher for minimizers using ahash.
- kmer
- K-mer representation with const generics and optimal storage
- minimizer
- Minimizer extraction and iteration
- minimizers_
control_ map - Minimizers Control Map (MCM)
- mphf_
config - MPHF (Minimal Perfect Hash Function) type configuration
- offsets
- Compact encoding of offsets into a bit-packed string set
- serialization
- Serialization and deserialization support for Dictionary
- sparse_
and_ skew_ index - Sparse and Skew Index for k-mer lookup
- spectrum_
preserving_ string_ set - Spectrum-Preserving String Set (SPSS)
- streaming_
query - Streaming query for efficient k-mer lookups
Macros§
- dispatch_
on_ k - Dispatch to the correct const generic
Kbased on a runtimekvalue.
Functions§
- version
- Version information