Expand description
A library to quickly compute (canonical) minimizers of DNA and text sequences.
The main functions are:
minimizer_positions: compute the positions of all minimizers of a sequence.canonical_minimizer_positions: compute the positions of all canonical minimizers of a sequence.
Adjacent equal positions are deduplicated, but since the canonical minimizer is not forward, a position could appear more than once.
The implementation uses SIMD by splitting each sequence into 8 chunks and processing those in parallel.
When using super-k-mers, use the _and_superkmer variants to additionally return a vector containing the index of the first window the minimizer is minimal.
The minimizer of a single window can be found using one_minimizer and [one_canonical_minimizer], but note that these functions are not nearly as efficient.
The scalar versions are mostly for testing only, and basically always slower.
§Minimizers
The code is explained in detail in our paper:
SimdMinimizers: Computing random minimizers, fast. Ragnar Groot Koerkamp, Igor Martayan, SEA 2025
Briefly, minimizers are defined using two parameters k and w.
Given a sequence of characters, all k-mers (substrings of length k) are hashed,
and for each window of w consecutive k-mers (of length l = w + k - 1 characters),
(the position of) the smallest k-mer is sampled.
Minimizers are found as follows:
- Split the input to 8 chunks that are processed in parallel using SIMD.
- Compute a 32-bit ntHash rolling hash of the k-mers.
- Use the ‘two stacks’ sliding window minimum on the top 16 bits of each hash.
- Break ties towards the leftmost position by storing the position in the bottom 16 bits.
- Compute 8 consecutive minimizer positions, and dedup them.
- Collect the deduplicated minimizer positions from all 8 chunks into a single vector.
§Canonical minimizers
Canonical minimizers have the property that the sampled k-mers of a DNA sequence are the same as those sampled from the reverse complement sequence.
This works as follows:
- ntHash is modified to use the canonical version that computes the xor of the hash of the forward and reverse complement k-mer.
- Compute the leftmost and rightmost minimal k-mer.
- Compute the ‘preferred’ strand of the current window as the one with more
TGcharacters. This requiresl=w+k-1to be odd for proper tie-breaking. - Return either the leftmost or rightmost smallest k-mer, depending on the preferred strand.
§Syncmers
Syncmers are (in our notation) windows of length l = w + k - 1 characters where the minimizer k-mer is a prefix or suffix.
(Or, in classical notation, k-mers with the smallest s-mer as prefix or suffix.)
These can be computed by using [fn@syncmers] or [canonical_syncmers] instead of minimizers or canonical_minimizers.
To obtain their values via Output::values_u64, l (rather than k) has to be at most 32.
Note that canonical syncmers are chosen as the minimum of the forward and reverse-complement k-mer representation.
§Input types
This crate depends on packed_seq to handle generic types of input sequences.
Most commonly, one should use packed_seq::PackedSeqVec for packed DNA sequences, but one can also simply wrap a sequence of ACTGactg characters in packed_seq::AsciiSeqVec.
Additionally, simd_minimizers works on general (ASCII) &[u8] text.
The main function provided by packed_seq is packed_seq::Seq::iter_bp, which splits the input into 8 chunks and iterates them in parallel using SIMD.
When the input is ASCII-encoded DNA, either use the AsciiSeq and AsciiSeqVec types, or (usually preferred) first convert to PackedSeqVec.
§Hash function
By default, the library uses the ntHash hash function, which maps each DNA base ACTG to a pseudo-random value using a table lookup.
This hash function is specifically designed to be fast for hashing DNA sequences with input type packed_seq::PackedSeq and packed_seq::AsciiSeq.
For general ASCII sequences (&[u8]), mulHash is used instead, which instead multiplies each character value by a pseudo-random constant.
The mul_hash module provides functions that always use mulHash, also for DNA sequences.
§Performance
This library depends on AVX2 or NEON SIMD instructions to achieve good performance.
Make sure to compile with -C target-cpu=native to enable these instructions.
See the ensure_simd crate for more details.
All functions take a out_vec: &mut Vec<u32> parameter to which positions are appended.
For best performance, re-use the same out_vec between invocations, and Vec::clear it before or after each call.
§Examples
§Scalar AsciiSeq
// Scalar ASCII version.
use simd_minimizers::packed_seq;
use packed_seq::{SeqVec, AsciiSeq};
let seq = b"ACGTGCTCAGAGACTCAG";
let ascii_seq = AsciiSeq(seq);
let k = 5;
let w = 7;
let positions = simd_minimizers::minimizer_positions(ascii_seq, k, w);
assert_eq!(positions, vec![4, 5, 8, 13]);§SIMD PackedSeq
// Packed SIMD version.
use simd_minimizers::packed_seq;
use packed_seq::{PackedSeqVec, SeqVec, Seq};
let seq = b"ACGTGCTCAGAGACTCAGAGGA";
let packed_seq = PackedSeqVec::from_ascii(seq);
let k = 5;
let w = 7;
// Unfortunately, `PackedSeqVec` can not `Deref` into a `PackedSeq`, so `as_slice` is needed.
// Since we also need the values, this uses the Builder API.
let mut fwd_pos = vec![];
let fwd_vals: Vec<_> = simd_minimizers::canonical_minimizers(k, w).run(packed_seq.as_slice(), &mut fwd_pos).values_u64().collect();
assert_eq!(fwd_pos, vec![0, 7, 9, 15]);
assert_eq!(fwd_vals, vec![
// T G C A C, CACGT is rc of ACGTG at pos 0
0b10_11_01_00_01,
// G A G A C, CAGAG is at pos 7
0b11_00_11_00_01,
// C A G A G, GAGAC is at pos 9
0b01_00_11_00_11,
// G A G A C, CAGAG is at pos 15
0b11_00_11_00_01
]);
// Check that reverse complement sequence has minimizers at 'reverse' positions.
let rc_packed_seq = packed_seq.as_slice().to_revcomp();
let mut rc_pos = Vec::new();
let mut rc_vals: Vec<_> = simd_minimizers::canonical_minimizers(k, w).run(rc_packed_seq.as_slice(), &mut rc_pos).values_u64().collect();
assert_eq!(rc_pos, vec![2, 8, 10, 17]);
for (fwd, &rc) in std::iter::zip(fwd_pos, rc_pos.iter().rev()) {
assert_eq!(fwd as usize, seq.len() - k - rc as usize);
}
rc_vals.reverse();
assert_eq!(rc_vals, fwd_vals);§Seeded hasher
// Packed SIMD version with seeded hashes.
use simd_minimizers::{packed_seq, seq_hash};
use packed_seq::{PackedSeqVec, SeqVec};
let seq = b"ACGTGCTCAGAGACTCAG";
let packed_seq = PackedSeqVec::from_ascii(seq);
let k = 5;
let w = 7;
let seed = 101010;
// Canonical by default. Use `NtHasher<false>` for forward-only.
let hasher = <seq_hash::NtHasher>::new_with_seed(k, seed);
let fwd_pos = simd_minimizers::canonical_minimizers(k, w).hasher(&hasher).run_once(packed_seq.as_slice());Re-exports§
pub use seq_hash;pub use seq_hash::packed_seq;
Modules§
- collect
- Collect (and dedup) SIMD-iterator values into a flat
Vec<u32>. - private
- Re-exported internals. Used for benchmarking, and not part of the semver-compatible stable API.
- syncmers
- Collect (and dedup) SIMD-iterator values into a flat
Vec<u32>.
Structs§
- Builder
CANONICAL: true for canonical minimizers.H: the kmer hasher to use.SkPos: type of super-k-mer position storage. Use()to disable super-k-mers.SYNCMER: 0 for minimizers, 1 for closed syncmers, 2 for open syncmers.- Cache
- Output
Functions§
- canonical_
closed_ syncmers - canonical_
minimizer_ positions - Positions of all canonical minimizers in the sequence.
- canonical_
minimizers - canonical_
open_ syncmers - closed_
syncmers - Return positions/values of closed syncmers of length
k+w-1. - minimizer_
positions - Positions of all minimizers in the sequence.
- minimizers
- one_
minimizer - Minimizer position of a single window.
- open_
syncmers - Return positions/values of open syncmers of length
k+w-1.