1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336
// Copyright (c) 2016 Adam Perry <adam.n.perry@gmail.com> // // This software may be modified and distributed under the terms of the MIT license. See the // LICENSE file for details. use libc::c_int; use parasail_sys::{parasail_result_free, parasail_nw_striped_profile_sat, parasail_sg_striped_profile_sat, parasail_sw_striped_profile_sat, parasail_sg_stats_striped_sat, parasail_sw_stats_striped_sat, parasail_sw_striped_sat}; use matrix::Matrix; use profile::Profile; /// Provides a score for global pairwise alignment, using a vectorized version of [Needleman-Wunsch](https://en.wikipedia.org/wiki/Needleman%E2%80%93Wunsch_algorithm). /// /// # Examples /// /// ``` /// # use parasailors::*; /// // create & lookup substitution matrices /// let identity_matrix = Matrix::new(MatrixType::Identity); /// /// let query = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// let profile_ident = Profile::new(query, &identity_matrix); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// assert_eq!(50, global_alignment_score(&profile_ident, reference, 1, 1)); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTCCTTTTTTNNNNNNNNN"; /// assert_eq!(48, global_alignment_score(&profile_ident, reference, 1, 1)); /// ``` pub fn global_alignment_score(query_profile: &Profile, database_sequence: &[u8], open_cost: i32, gap_extend_cost: i32) -> i32 { unsafe { let result = parasail_nw_striped_profile_sat(**query_profile, database_sequence.as_ptr(), database_sequence.len() as c_int, open_cost, gap_extend_cost); let score = (*result).score; parasail_result_free(result); score } } /// Provides a score for semi-global pairwise alignment using a vectorized algorithm. /// /// This results in a score that corresponds to a global alignment for the query sequence (i.e. the sequence in the `Profile`) and a local alignment for the reference sequence. This is particularly useful when checking for the presence of an NGS read in a much longer reference sequence. This behaves like a global alignment, except that gaps at the start or end of the reference sequence's alignment are ignored. /// /// # Examples /// /// ``` /// # use parasailors::*; /// # let identity_matrix = Matrix::new(MatrixType::Identity); /// let query = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// let profile_ident = Profile::new(query, &identity_matrix); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// assert_eq!(50, semi_global_alignment_score(&profile_ident, reference, 1, 1)); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTCCTTTTTTNNNNNNNNN"; /// assert_eq!(48, semi_global_alignment_score(&profile_ident, reference, 1, 1)); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTT"; /// assert_eq!(35, semi_global_alignment_score(&profile_ident, reference, 1, 1)); /// ``` pub fn semi_global_alignment_score(query_profile: &Profile, database_sequence: &[u8], open_cost: i32, gap_extend_cost: i32) -> i32 { unsafe { let result = parasail_sg_striped_profile_sat(**query_profile, database_sequence.as_ptr(), database_sequence.len() as c_int, open_cost, gap_extend_cost); let score = (*result).score; parasail_result_free(result); score } } /// Returns a score for local pairwise alignment using a vectorized version of [Smith-Waterman](https://en.wikipedia.org/wiki/Smith%E2%80%93Waterman_algorithm). /// /// # Examples /// /// ``` /// # use parasailors::*; /// # let identity_matrix = Matrix::new(MatrixType::Identity); /// let query = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// let profile_ident = Profile::new(query, &identity_matrix); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// assert_eq!(50, local_alignment_score(&profile_ident, reference, 1, 1)); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTCCTTTTTTNNNNNNNNN"; /// assert_eq!(48, local_alignment_score(&profile_ident, reference, 1, 1)); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTT"; /// assert_eq!(35, local_alignment_score(&profile_ident, reference, 1, 1)); /// ``` pub fn local_alignment_score(query_profile: &Profile, database_sequence: &[u8], open_cost: i32, gap_extend_cost: i32) -> i32 { unsafe { let result = parasail_sw_striped_profile_sat(**query_profile, database_sequence.as_ptr(), database_sequence.len() as c_int, open_cost, gap_extend_cost); let score = (*result).score; parasail_result_free(result); score } } /// Returns a score for local pairwise alignment using a vectorized version of [Smith-Waterman](https://en.wikipedia.org/wiki/Smith%E2%80%93Waterman_algorithm). /// /// # Examples /// /// ``` /// # use parasailors::*; /// let identity_matrix = Matrix::new(MatrixType::Identity); /// let query = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// assert_eq!(50, local_alignment_score_no_profile(query, reference, 1, 1, &identity_matrix)); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTCCTTTTTTNNNNNNNNN"; /// assert_eq!(48, local_alignment_score_no_profile(query, reference, 1, 1, &identity_matrix)); /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTT"; /// assert_eq!(35, local_alignment_score_no_profile(query, reference, 1, 1, &identity_matrix)); /// ``` pub fn local_alignment_score_no_profile(query: &[u8], database_sequence: &[u8], open_cost: i32, gap_extend_cost: i32, sub_matrix: &Matrix) -> i32 { unsafe { let result = parasail_sw_striped_sat(query.as_ptr(), query.len() as c_int, database_sequence.as_ptr(), database_sequence.len() as c_int, open_cost, gap_extend_cost, **sub_matrix); let score = (*result).score; parasail_result_free(result); score } } /// Stores statistics from an alignment. pub struct AlignmentStats { /// The score according to the substitution matrix and gap penalty scheme used. pub score: i64, /// Number of exactly matching characters. pub num_matches: u64, /// Number of positively scoring character substitutions (this is the same as num_matches when used an identity matrix). pub num_positive_subs: u64, /// The length of the found alignment. pub align_length: usize, /// The starting index (0-based) of the alignment in the query (usually 0). pub query_end: usize, /// The starting index (0-based) of the alignment in the reference. pub ref_end: usize, } /// Provides statistics for semi-global pairwise alignment using a vectorized algorithm. /// /// This results in a series of statistics, including a score that corresponds to a global alignment for the query sequence and a local alignment for the reference sequence. This is particularly useful when checking for the presence of an NGS read in a much longer reference sequence. This behaves like a global alignment, except that gaps at the start or end of the reference sequence's alignment are ignored. /// /// Other statistics include the number of matching characters, the number of positive substitutions, the length of the found alignment, and the starting point in both sequences where the alignment starts. /// /// # Examples /// /// ``` /// # use parasailors::*; /// let identity_matrix = Matrix::new(MatrixType::Identity); /// let query = b"AAAACCCCCCCCCCGGG"; /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// let stats = semi_global_alignment_stats(query, reference, 1, 1, &identity_matrix); /// assert_eq!(17, stats.score); /// assert_eq!(17, stats.num_matches); /// assert_eq!(17, stats.num_positive_subs); /// assert_eq!(17, stats.align_length); /// assert_eq!(17, stats.query_end); /// assert_eq!(23, stats.ref_end); /// ``` pub fn semi_global_alignment_stats(query_sequence: &[u8], database_sequence: &[u8], open_cost: i32, gap_extend_cost: i32, substitution_matrix: &::matrix::Matrix) -> AlignmentStats { unsafe { let result = parasail_sg_stats_striped_sat(query_sequence.as_ptr(), query_sequence.len() as c_int, database_sequence.as_ptr(), database_sequence.len() as c_int, open_cost, gap_extend_cost, **substitution_matrix); let score = (*result).score as i64; let num_matches = (*result).matches as u64; let num_subs = (*result).similar as u64; let align_len = (*result).length as usize; // calculate start from end let query_end = (*result).end_query as usize + 1; let ref_end = (*result).end_ref as usize + 1; parasail_result_free(result); AlignmentStats { score: score, num_matches: num_matches, num_positive_subs: num_subs, align_length: align_len, query_end: query_end, ref_end: ref_end, } } } /// Provides statistics for local pairwise alignment using a vectorized algorithm. /// /// # Examples /// /// ``` /// # use parasailors::*; /// let identity_matrix = Matrix::new(MatrixType::Identity); /// let query = b"AAAACCCCCCCCCCGGG"; /// /// let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; /// let stats = local_alignment_stats(query, reference, 1, 1, &identity_matrix); /// assert_eq!(17, stats.score); /// assert_eq!(17, stats.num_matches); /// assert_eq!(17, stats.num_positive_subs); /// assert_eq!(17, stats.align_length); /// assert_eq!(17, stats.query_end); /// assert_eq!(23, stats.ref_end); /// ``` pub fn local_alignment_stats(query_sequence: &[u8], database_sequence: &[u8], open_cost: i32, gap_extend_cost: i32, substitution_matrix: &::matrix::Matrix) -> AlignmentStats { unsafe { let result = parasail_sw_stats_striped_sat(query_sequence.as_ptr(), query_sequence.len() as c_int, database_sequence.as_ptr(), database_sequence.len() as c_int, open_cost, gap_extend_cost, **substitution_matrix); let score = (*result).score as i64; let num_matches = (*result).matches as u64; let num_subs = (*result).similar as u64; let align_len = (*result).length as usize; // calculate start from end let query_end = (*result).end_query as usize + 1; let ref_end = (*result).end_ref as usize + 1; parasail_result_free(result); AlignmentStats { score: score, num_matches: num_matches, num_positive_subs: num_subs, align_length: align_len, query_end: query_end, ref_end: ref_end, } } } #[test] fn test_semiglobal_stats() { use matrix::{Matrix, MatrixType}; use std::str; let identity_matrix = Matrix::new(MatrixType::Identity); let query = b"AAAACCCCCCCCCCGGG"; let reference = b"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTTNNNNNNNNN"; let stats = semi_global_alignment_stats(query, reference, 1, 1, &identity_matrix); assert_eq!(17, stats.score); assert_eq!(17, stats.num_matches); assert_eq!(17, stats.num_positive_subs); assert_eq!(17, stats.align_length); assert_eq!(17, stats.query_end); assert_eq!(23, stats.ref_end); assert_eq!(str::from_utf8(query).unwrap(), str::from_utf8(&query[stats.query_end - stats.align_length..stats.query_end]) .unwrap()); assert_eq!(str::from_utf8(query).unwrap(), str::from_utf8(&reference[stats.ref_end - stats.align_length..stats.ref_end]) .unwrap()); // these two test cases "borrowed" mutably from rust-bio let x = b"ACCGTGGAT"; let y = b"AAAAACCGTTGAT"; let ident_with_penalty = Matrix::new(MatrixType::IdentityWithPenalty); let alignment = semi_global_alignment_stats(x, y, 5, 1, &ident_with_penalty); assert_eq!(7, alignment.score); assert_eq!(13, alignment.ref_end); assert_eq!(9, alignment.query_end); let x = b"CCGGCA"; let y = b"ACCGTTGACGC"; let alignment = semi_global_alignment_stats(x, y, 5, 1, &ident_with_penalty); assert_eq!(1, alignment.score); assert_eq!(1, alignment.ref_end); assert_eq!(6, alignment.query_end); }