1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284
#![doc = include_str!("../README.md")]
extern crate diced;
extern crate pyo3;
use pyo3::exceptions::PyIndexError;
use pyo3::prelude::*;
use pyo3::pybacked::PyBackedStr;
use pyo3::types::PySlice;
use pyo3::types::PyString;
/// A sequence region.
#[pyclass(module = "diced.lib", frozen, subclass)]
pub struct Region {
region: diced::Region<PyBackedStr>,
}
#[pymethods]
impl Region {
#[new]
pub fn __new__<'py>(
py: Python<'py>,
sequence: PyBackedStr,
start: usize,
end: usize,
) -> PyResult<PyClassInitializer<Self>> {
if start > end || start > sequence.len() || end > sequence.len() {
let s = PySlice::new_bound(py, start as isize, end as isize, 1);
return Err(PyIndexError::new_err(s.to_object(py)));
}
Ok(Region {
region: diced::Region::new(sequence, start, end),
}
.into())
}
/// `int`: The start coordinate of the region (zero-based).
#[getter]
pub fn start(&self) -> usize {
self.region.start()
}
/// `int`: The end coordinate of the region (zero-based, exclusive).
#[getter]
pub fn end(&self) -> usize {
self.region.end()
}
/// Get the sequence region as a string.
pub fn __str__<'py>(&self, py: Python<'py>) -> Bound<'py, PyString> {
PyString::new_bound(py, self.region.as_str())
}
}
/// A CRISPR repeat.
#[pyclass(module="diced.lib", extends=Region)]
pub struct Repeat {}
#[pymethods]
impl Repeat {
#[new]
pub fn __new__<'py>(
py: Python<'py>,
sequence: PyBackedStr,
start: usize,
end: usize,
) -> PyResult<PyClassInitializer<Self>> {
Region::__new__(py, sequence, start, end).map(|r| r.add_subclass(Repeat {}))
}
}
/// A list of repeats inside a CRISPR region.
#[pyclass(module = "diced.lib", sequence)]
pub struct Repeats {
crispr: Py<Crispr>,
}
#[pymethods]
impl Repeats {
pub fn __len__<'py>(&self, py: Python<'py>) -> usize {
self.crispr.borrow(py).crispr.len()
}
pub fn __getitem__<'py>(&self, py: Python<'py>, index: usize) -> PyResult<Py<Repeat>> {
self.crispr
.bind(py)
.borrow()
.crispr
.repeats()
.nth(index)
.ok_or(PyIndexError::new_err(index))
.and_then(|region| {
Py::new(
py,
PyClassInitializer::from(Region { region }).add_subclass(Repeat {}),
)
})
}
}
/// A CRISPR spacer.
#[pyclass(module="diced.lib", extends=Region)]
pub struct Spacer {}
#[pymethods]
impl Spacer {
#[new]
pub fn __new__<'py>(
py: Python<'py>,
sequence: PyBackedStr,
start: usize,
end: usize,
) -> PyResult<PyClassInitializer<Self>> {
Region::__new__(py, sequence, start, end).map(|r| r.add_subclass(Spacer {}))
}
}
/// A list of spacers inside a CRISPR region.
#[pyclass(module = "diced.lib", sequence)]
pub struct Spacers {
crispr: Py<Crispr>,
}
#[pymethods]
impl Spacers {
pub fn __len__<'py>(&self, py: Python<'py>) -> usize {
self.crispr.borrow(py).crispr.len().saturating_sub(1)
}
pub fn __getitem__<'py>(&self, py: Python<'py>, index: usize) -> PyResult<Py<Spacer>> {
self.crispr
.bind(py)
.borrow()
.crispr
.spacers()
.nth(index)
.ok_or(PyIndexError::new_err(index))
.and_then(|region| {
Py::new(
py,
PyClassInitializer::from(Region { region }).add_subclass(Spacer {}),
)
})
}
}
/// A CRISPR region in a nucleotide sequence.
#[pyclass(module = "diced.lib")]
pub struct Crispr {
crispr: diced::Crispr<PyBackedStr>,
}
#[pymethods]
impl Crispr {
/// `int`: The start coordinate of the CRISPR region (zero-based).
#[getter]
pub fn start(&self) -> usize {
self.crispr.start()
}
/// `int`: The end coordinate of the CRISPR region (zero-based, exclusive).
#[getter]
pub fn end(&self) -> usize {
self.crispr.end()
}
/// `~diced.Repeats`: The list of repeats inside the CRISPR region.
#[getter]
pub fn repeats(slf: Py<Self>) -> Repeats {
Repeats { crispr: slf }
}
/// `~diced.Spacers`: The list of spacers inside the CRISPR region.
#[getter]
pub fn spacers(slf: Py<Self>) -> Spacers {
Spacers { crispr: slf }
}
pub fn __len__(&self) -> usize {
self.crispr.len()
}
pub fn __str__<'py>(&self, py: Python<'py>) -> Bound<'py, PyString> {
PyString::new_bound(py, self.crispr.to_region().as_str())
}
}
/// A scanner for iterating on the CRISPR regions of a genome.
#[pyclass(module = "diced.lib")]
pub struct Scanner {
scanner: diced::Scanner<PyBackedStr>,
}
#[pymethods]
impl Scanner {
fn __iter__(slf: PyRef<Self>) -> PyRef<Self> {
slf
}
/// Return the next CRISPR region, if any.
///
/// Returns:
/// `~diced.Crispr`: The next CRISPR region in the sequence.
///
/// Raises:
/// `StopIteration`: When the end of the sequence has been reached
/// without finding new CRISPR regions.
///
fn __next__<'py>(&mut self, py: Python<'py>) -> PyResult<Option<Crispr>> {
match py.allow_threads(move || self.scanner.next()) {
Some(crispr) => Ok(Some(Crispr { crispr })),
None => Ok(None),
}
}
/// `str`: The genomic sequence being scanned.
#[getter]
fn sequence<'py>(&self, py: Python<'py>) -> Py<PyAny> {
self.scanner.sequence().clone().to_object(py)
}
}
/// Scan a genome sequence for CRISPRs repeats.
///
/// Arguments:
/// sequence (`str`): A string containing the genomic sequence to build
/// a scanner for.
///
/// Returns:
/// `~diced.Scanner`: A scanner yielding CRISPRs in the given contig.
///
#[pyfunction]
pub fn scan(sequence: PyBackedStr) -> PyResult<Scanner> {
let builder = diced::ScannerBuilder::new();
let scanner = builder.scan(sequence);
Ok(Scanner { scanner })
}
/// PyO3 bindings to ``diced``, a library for CRISPRs detection.
///
/// Diced is re-implementation of MinCED, a method developed by
/// `Connor T. Skennerton <https://github.com/ctSkennerton>`_ to identify
/// CRISPRs in isolate and metagenomic-assembled genomes. It was derived
/// from the CRISPR recognition tool developed by Charles Bland *et al.*.
///
/// Example:
/// Load a genome from a FASTA file using Biopython::
///
/// >>> import Bio.SeqIO
/// >>> record = Bio.SeqIO.read("Aquifex_aeolicus_VF5.fna", "fasta")
///
/// Detect CRISPR regions with Diced using the default parameters::
///
/// >>> import diced
/// >>> for crispr in diced.scan(str(record.seq[:300000])):
/// ... print(
/// ... crispr.start,
/// ... crispr.end,
/// ... len(crispr.repeats),
/// ... crispr.repeats[0],
/// ... )
/// 156459 156767 5 GTTCCTAATGTACCGTGTGGAGTTGAAACC
/// 244560 244791 4 GTTTCAACTCCACACGGTACATTAGGAAC
/// 279263 279555 5 GTTTTAACTCCACACGGTACATTAGAAAC
///
#[pymodule]
#[pyo3(name = "lib")]
pub fn init(_py: Python, m: Bound<PyModule>) -> PyResult<()> {
m.add("__package__", "diced")?;
m.add("__version__", env!("CARGO_PKG_VERSION"))?;
m.add("__author__", env!("CARGO_PKG_AUTHORS").replace(':', "\n"))?;
m.add_class::<Crispr>()?;
m.add_class::<Region>()?;
m.add_class::<Scanner>()?;
m.add_class::<Repeat>()?;
m.add_class::<Repeats>()?;
m.add_class::<Spacer>()?;
m.add_class::<Spacers>()?;
m.add_function(wrap_pyfunction!(scan, &m)?)?;
Ok(())
}