[−][src]Function protein_translate::translate
pub fn translate(seq: &[u8]) -> String
Translate DNA or RNA sequence into a peptide.
Examples
use protein_translate::translate; fn dna_example() { let dna = b"GCTAGTCGTATCGTAGCTAGTC"; let peptide = translate(dna); assert_eq!(&peptide, "ASRIVAS"); } fn rna_example() { let rna = b"GCUAGUCGUAUCGUAGCUAGUC"; let peptide = translate(rna); assert_eq!(&peptide, "ASRIVAS"); } fn shift_reading_frame() { // To shift the reading frame, pass in a slice // skipping the first 1-2 nucleotides. let dna = b"GCTAGTCGTATCGTAGCTAGTC"; let peptide_frame2 = translate(&dna[1..]); assert_eq!(&peptide_frame2, "LVVS*LV"); let peptide_frame3 = translate(&dna[2..]); assert_eq!(&peptide_frame3, "*SYRS*"); }