Struct nucleic_acid::FMIndex

pub struct FMIndex { /* fields omitted */ }

Ferragina-Manzini index (or Full-text index in Minute space) for finding occurrences of substrings in O(1) time.

use nucleic_acid::FMIndex;

let text = String::from("GCGTGCCCAGGGCACTGCCGCTGCAGGCGTAGGCATCGCATCACACGCGT");
let index = FMIndex::new(text.as_bytes());

// count the occurrences
assert_eq!(0, index.count("CCCCC"));
assert_eq!(3, index.count("TG"));

// ... or get their positions
assert_eq!(index.search("GCGT"), vec![46, 26, 0]);

The current implementation of FM-index is a memory killer, since it stores positions of all bytes in the given data. For the human genome (~3 GB), it consumed ~27 GB of RAM to build the index (in ~4 mins).

That said, it still returns the match results in a few microseconds.

Methods

impl FMIndex

fn new(data: &[u8]) -> FMIndex

Generate an FM-index for the input data.

fn bwt(&self) -> &[u8]

Get the reference to the inner BWT data.

Note that the length of BWT is one more than the length of the actual text, since it has a null byte to indicate empty string.

fn new_from_bwt(bwt_data: Vec<u8>) -> FMIndex

Generate the FM-index from the BWT data.

It's not a good idea to generate FM-index from scratch all the time, especially for large inputs. This would be very useful when your data is large and remains constant for a while.

FM-index internally uses BWT, and BWT is generated from the suffix array, which takes a lot of time. If your input doesn't change, then it's better to get the BWT data (using bwt method), write it to a file and generate the index from that in the future.

fn nearest(&self, idx: usize, ch: u8) -> usize

Get the nearest position of a character in the internal BWT data.

The count and search methods rely on this method for finding occurrences. For example, we can do soemthing like this,

use nucleic_acid::FMIndex;
let fm = FMIndex::new(b"Hello, Hello, Hello" as &[u8]);

// initially, the range should be the length of the BWT
let mut top = 0;
let mut bottom = fm.bwt().len();
let query = b"llo";

// feed the characters in the reverse
for ch in query.iter().rev() {
    top = fm.nearest(top, *ch);
    bottom = fm.nearest(bottom, *ch);
    if top >= bottom {
        return
    }
}

// If we get a valid range, then everything in that range is a valid match.
// This way, we can get both the count and positions...
assert_eq!(3, bottom - top);
assert_eq!(vec![17, 10, 3], (top..bottom).map(|i| fm[i]).collect::<Vec<_>>());

This is backward searching. As you feed in the characters along with a position, nearest will give you a new position in the index. Once the range becomes invalid (which happens when the substring doesn't exist), we can bail out. On the contrary, if the range remains valid after you've fed in all the characters, then every value within in that range is an occurrence.

So, this is useful when you want to cache the repeating ranges. With this, you can build your own count/search functions with caching. It's also useful for making custom approximate matching functions by backtracking whenever there's an invalid range.

fn count(&self, query: &str) -> usize

Count the occurrences of the substring in the original data.

fn search(&self, query: &str) -> Vec<usize>

Get the positions of occurrences of substring in the original data.

Trait Implementations

impl Clone for FMIndex

fn clone(&self) -> FMIndex

Returns a copy of the value.

fn clone_from(&mut self, source: &Self)

Performs copy-assignment from source.

impl Debug for FMIndex

fn fmt(&self, __arg_0: &mut Formatter) -> Result

Formats the value using the given formatter.

impl Index<usize> for FMIndex

type Output = u32

The returned type after indexing

fn index(&self, i: usize) -> &u32

The method for the indexing (container[index]) operation