Expand description

LT FM-Index

lt-fm-index is library for locate and count nucleotide and amino acid sequence string.
lt-fm-index use lookup table (LT) in count table

Description

  • Fm-index is a data structure for exact pattern matching.
  • LT is precalculated count table containing all kmer occurrences.
  • LT allows you to find the first k-mer pattern at once.

Features

  • LtFmIndex is generated from Text
  • LtFmIndex have two functions for Pattern
    • count: Count the number of times the Pattern appears in Text.
    • locate: Locate the start index in which the Pattern appears in Text.
  • Supports four types of text.
    • NucleotideOnly supports a text with only genetic nucleotide sequence (ACGT).
    • NucleotideWithNoise supports a text containing non-nucleotide sequence.
    • AminoacidOnly supports a text with only amino acid sequence.
    • AminoacidWithNoise supports a text containing non-amino acid sequence.
  • The last character of each text type is treated as a wildcard.
    • The last characters of each text type are T, _, Y and _.
    • Wildcard is assigned to all non-supported characters.
    • For example, in NucleotideOnly, pattern of ACGTXYZ can be matched with ACGTTTT. Because X, Y and Z are not in ACG (nucleotide except T). And lt-fm-index generated with text of ACGTXYZ indexes the text as ACGTTTT.
  • BWT is stored with rank count tables in every 64 or 128 intervals.

Examples

1. Use LtFmIndex to count and locate pattern.

use lt_fm_index::LtFmIndexBuilder;

// (1) Define builder for lt-fm-index
let builder = LtFmIndexBuilder::new()
    .use_nucleotide_with_noise()
    .set_lookup_table_kmer_size(4).unwrap()
    .set_suffix_array_sampling_ratio(2).unwrap();

// (2) Generate lt-fm-index with text
let text = b"CTCCGTACACCTGTTTCGTATCGGANNNN".to_vec();
let lt_fm_index = builder.build(text); // text is consumed

// (3) Match with pattern
let pattern = b"TA".to_vec();
//   - count
let count = lt_fm_index.count(&pattern);
assert_eq!(count, 2);
//   - locate
let locations = lt_fm_index.locate(&pattern);
assert_eq!(locations, vec![5,18]);

2. Save and load LtFmIndex

use lt_fm_index::{LtFmIndex, LtFmIndexBuilder};

// (1) Generate lt-fm-index
let text = b"CTCCGTACACCTGTTTCGTATCGGA".to_vec();
let lt_fm_index_to_save = LtFmIndexBuilder::new().build(text);

// (2) Save lt-fm-index to buffer
let mut buffer = Vec::new();
lt_fm_index_to_save.save_to(&mut buffer).unwrap();

// (3) Load lt-fm-index from buffer
let lt_fm_index_loaded = LtFmIndex::load_from(&buffer[..]).unwrap();

assert_eq!(lt_fm_index_to_save, lt_fm_index_loaded);

Repository

https://github.com/baku4/lt-fm-index

Doc

https://docs.rs/lt-fm-index/

Reference

  • Ferragina, P., et al. (2004). An Alphabet-Friendly FM-Index, Springer Berlin Heidelberg: 150-160.
  • Anderson, T. and T. J. Wheeler (2021). An optimized FM-index library for nucleotide and amino acid search, Cold Spring Harbor Laboratory.
  • Wang, Y., X. Li, D. Zang, G. Tan and N. Sun (2018). Accelerating FM-index Search for Genomic Data Processing, ACM.
  • Yuta Mori. libdivsufsort

Structs

Enums

Type Definitions