Crate lt_fm_index[−][src]
Expand description
LT FM-Index
lt-fm-index
is library for locate and count nucleotide sequence (ATGC) string.
lt-fm-index
using k-mer lookup table (As you noticed, LT stands for lookup table).
Description
- Fm-index is a data structure used for pattern matching.
- K-mer lookup table(KLT) is precalculated count table containing all kmer occurrences.
- With KLT, you can find the first k-mer pattern at once.
- Supports two types of text.
FmIndexOn
supports a text with only genetic nucleotide sequence (ACGT).FmIndexNn
supports a text containing non-nucleotide sequence.FmIndexNn
treats all non-nucleotide as the same character.
- CAVEAT! This
crate
is not stable. Functions can be changed without notice.
Features
- Fm-index using KLT with specified k-mer size.
- Suffix array compression with sampling ratio.
- BWT and suffix array are generated using
libdivsufsort
library. - BWT(burrow wheeler transformed) string and occurrence array (OA) are aligned in one block of 64 strings.
- There are two main functions.
- count: Count the number of patterns in the text
- locate: Locate pattern index in text (KLT can be specified to enable or not)
Examples
Use FmIndexConfig to generate FmIndex
use lt_fm_index::FmIndexConfig; // (1) Define configuration for fm-index let fmi_config = FmIndexConfig::new() .set_kmer_lookup_table(8) .set_suffix_array_sampling_ratio(4) .contain_non_nucleotide(); // Default is `true` // (2) Generate fm-index with text let text = b"CTCCGTACACCTGTTTCGTATCGGANNN".to_vec(); let fm_index = fmi_config.generate_fmindex(text); // text is consumed // (3) Match with pattern let pattern = b"TA".to_vec(); // - count let count = fm_index.count(&pattern); assert_eq!(count, 2); // - locate without k-mer lookup table let locations = fm_index.locate_wo_klt(&pattern); assert_eq!(locations, vec![5,18]); // - locate with k-mer lookup table let locations = fm_index.locate_w_klt(&pattern); assert_eq!(locations, vec![5,18]);
Use FmIndexOn and FmIndexNn struct to generate FmIndex
use lt_fm_index::{FmIndexConfig, FmIndex, FmIndexOn, FmIndexNn}; // (1) Define configuration for fm-index let fmi_config = FmIndexConfig::new() .set_kmer_lookup_table(8) .set_suffix_array_sampling_ratio(4) .contain_non_nucleotide(); // (2) Generate fm-index with text // - Use `FmIndexOn` struct directly let text_only_nc = b"CTCCGTACACCTGTTTCGTATCGGA".to_vec(); let fm_index_on = FmIndexOn::new(&fmi_config, text_only_nc); // `only_nucleotide` field of config is ignored // - Use `FmIndexNn` struct directly let text_non_nc = b"CTCCGTACACCTGTTTCGTATCGGANNN".to_vec(); let fm_index_nn = FmIndexNn::new(&fmi_config, text_non_nc); // (3) match with pattern let pattern = b"TA".to_vec(); // - count let count_on = fm_index_on.count(&pattern); let count_nn = fm_index_nn.count(&pattern); assert_eq!(count_on, count_nn); // - locate without k-mer lookup table let locations_on = fm_index_on.locate_wo_klt(&pattern); let locations_nn = fm_index_nn.locate_wo_klt(&pattern); assert_eq!(locations_on, locations_nn); // - locate with k-mer lookup table let locations_on = fm_index_on.locate_w_klt(&pattern); let locations_nn = fm_index_nn.locate_w_klt(&pattern); assert_eq!(locations_on, locations_nn);
- What’s the difference?
- The
FmIndexConfig::generate_fmindex()
generatesBox<dyn FmIndex>
type, while thenew()
function of structs generate struct that are not surrounded byBox
.
- The
Write and read FmIndex
use lt_fm_index::{FmIndexConfig, FmIndex, FmIndexOn, FmIndexNn}; // (1) Generate `FmIndex` let fmi_config = FmIndexConfig::new() .set_kmer_lookup_table(8) .set_suffix_array_sampling_ratio(4); let text = b"CTCCGTACACCTGTTTCGTATCGGA".to_vec(); let fm_index_pre = FmIndexOn::new(&fmi_config, text); // text is consumed // (2) Write fm-index to buffer (or file path) let mut buffer = Vec::new(); fm_index_pre.write_index_to(&mut buffer).unwrap(); // (3) Read fm-index from buffer (or file path) let fm_index_pro = FmIndexOn::read_index_from(&buffer[..]).unwrap(); assert_eq!(fm_index_pre, fm_index_pro);
Future works
- Support SIMD for BWT block compression.
- Length of texts can be
32bit
integer
Repository
https://github.com/baku4/lt-fm-index
Doc
Reference
- Ferragina, P., et al. (2004). An Alphabet-Friendly FM-Index, Springer Berlin Heidelberg: 150-160.
- Anderson, T. and T. J. Wheeler (2021). An optimized FM-index library for nucleotide and amino acid search, Cold Spring Harbor Laboratory.
- Wang, Y., X. Li, D. Zang, G. Tan and N. Sun (2018). Accelerating FM-index Search for Genomic Data Processing, ACM.
- Yuta Mori.
libdivsufsort
Re-exports
Modules
Structs
Configurations for FmIndex