Crate lt_fm_index[][src]

Expand description

LT FM-Index

lt-fm-index is library for locate and count nucleotide sequence (ATGC) string.
lt-fm-index using k-mer lookup table (As you noticed, LT stands for lookup table).

Description

  • Fm-index is a data structure used for pattern matching.
  • K-mer lookup table(KLT) is precalculated count table containing all kmer occurrences.
  • With KLT, you can find the first k-mer pattern at once.
  • Supports two types of text.
    • FmIndexOn supports a text with only genetic nucleotide sequence (ACGT).
    • FmIndexNn supports a text containing non-nucleotide sequence.
      • FmIndexNn treats all non-nucleotide as the same character.
  • CAVEAT! This crate is not stable. Functions can be changed without notice.

Features

  • Fm-index using KLT with specified k-mer size.
  • Suffix array compression with sampling ratio.
  • BWT and suffix array are generated using libdivsufsort library.
  • BWT(burrow wheeler transformed) string and occurrence array (OA) are aligned in one block of 64 strings.
  • There are two main functions.
    • count: Count the number of patterns in the text
    • locate: Locate pattern index in text (KLT can be specified to enable or not)

Examples

Use FmIndexConfig to generate FmIndex

use lt_fm_index::FmIndexConfig;
 
// (1) Define configuration for fm-index
let fmi_config = FmIndexConfig::new()
	.set_kmer_lookup_table(8)
	.set_suffix_array_sampling_ratio(4)
	.contain_non_nucleotide(); // Default is `true`
 
// (2) Generate fm-index with text
let text = b"CTCCGTACACCTGTTTCGTATCGGANNN".to_vec();
let fm_index = fmi_config.generate_fmindex(text); // text is consumed
 
// (3) Match with pattern
let pattern = b"TA".to_vec();
//   - count
let count = fm_index.count(&pattern);
assert_eq!(count, 2);
//   - locate without k-mer lookup table
let locations = fm_index.locate_wo_klt(&pattern);
assert_eq!(locations, vec![5,18]);
//   - locate with k-mer lookup table
let locations = fm_index.locate_w_klt(&pattern);
assert_eq!(locations, vec![5,18]);

Use FmIndexOn and FmIndexNn struct to generate FmIndex

use lt_fm_index::{FmIndexConfig, FmIndex, FmIndexOn, FmIndexNn};
 
// (1) Define configuration for fm-index
let fmi_config = FmIndexConfig::new()
	.set_kmer_lookup_table(8)
	.set_suffix_array_sampling_ratio(4)
	.contain_non_nucleotide();
 
// (2) Generate fm-index with text
//   - Use `FmIndexOn` struct directly
let text_only_nc = b"CTCCGTACACCTGTTTCGTATCGGA".to_vec();
let fm_index_on = FmIndexOn::new(&fmi_config, text_only_nc); // `only_nucleotide` field of config is ignored
//   - Use `FmIndexNn` struct directly
let text_non_nc = b"CTCCGTACACCTGTTTCGTATCGGANNN".to_vec();
let fm_index_nn = FmIndexNn::new(&fmi_config, text_non_nc);
 
// (3) match with pattern
let pattern = b"TA".to_vec();
//   - count
let count_on = fm_index_on.count(&pattern);
let count_nn = fm_index_nn.count(&pattern);
assert_eq!(count_on, count_nn);
//   - locate without k-mer lookup table
let locations_on = fm_index_on.locate_wo_klt(&pattern);
let locations_nn = fm_index_nn.locate_wo_klt(&pattern);
assert_eq!(locations_on, locations_nn);
//   - locate with k-mer lookup table
let locations_on = fm_index_on.locate_w_klt(&pattern);
let locations_nn = fm_index_nn.locate_w_klt(&pattern);
assert_eq!(locations_on, locations_nn);
  • What’s the difference?
    • The FmIndexConfig::generate_fmindex() generates Box<dyn FmIndex> type, while the new() function of structs generate struct that are not surrounded by Box.

Write and read FmIndex

use lt_fm_index::{FmIndexConfig, FmIndex, FmIndexOn, FmIndexNn};

// (1) Generate `FmIndex`
let fmi_config = FmIndexConfig::new()
	.set_kmer_lookup_table(8)
	.set_suffix_array_sampling_ratio(4);
let text = b"CTCCGTACACCTGTTTCGTATCGGA".to_vec();
let fm_index_pre = FmIndexOn::new(&fmi_config, text); // text is consumed
 
// (2) Write fm-index to buffer (or file path)
let mut buffer = Vec::new();
fm_index_pre.write_index_to(&mut buffer).unwrap();
 
// (3) Read fm-index from buffer (or file path)
let fm_index_pro = FmIndexOn::read_index_from(&buffer[..]).unwrap();
 
assert_eq!(fm_index_pre, fm_index_pro);

Future works

  • Support SIMD for BWT block compression.
  • Length of texts can be 32bit integer

Repository

https://github.com/baku4/lt-fm-index

Doc

https://docs.rs/lt-fm-index/

Reference

  • Ferragina, P., et al. (2004). An Alphabet-Friendly FM-Index, Springer Berlin Heidelberg: 150-160.
  • Anderson, T. and T. J. Wheeler (2021). An optimized FM-index library for nucleotide and amino acid search, Cold Spring Harbor Laboratory.
  • Wang, Y., X. Li, D. Zang, G. Tan and N. Sun (2018). Accelerating FM-index Search for Genomic Data Processing, ACM.
  • Yuta Mori. libdivsufsort

Re-exports

pub use fmindex_on::FmIndexOn;
pub use fmindex_nn::FmIndexNn;

Modules

Structs

Configurations for FmIndex

Traits