[](https://travis-ci.org/johanneskoester/rust-bio)
# Rust-Bio, a bioinformatics library for Rust.
This library provides implementations of many algorithms and data structures
that are useful for bioinformatics.
All provided implementations are rigorously tested via continuous
integration.
Currently, rust-bio provides
* most major pattern matching algorithms,
* pairwise alignment,
* suffix arrays,
* BWT and FM-Index,
* FMD-Index for finding supermaximal exact matches,
* a q-gram index,
* a rank/select data structure,
* FastQ and Fasta readers and writers.
For reading and writing BAM and BCF files, have a look at https://github.com/christopher-schroeder/rust-htslib.
## Resources
* Homepage: https://github.com/johanneskoester/rust-bio
* API documentation: https://johanneskoester.github.io/rust-bio
* Continuous integration tests: https://travis-ci.org/johanneskoester/rust-bio
* Roadmap: https://github.com/johanneskoester/rust-bio/issues/3
## Usage
To use rust-bio in your Rust project, add the following to your `Cargo.toml`
```toml
[dependencies]
bio = "*"
```
and import the crate from your source code:
```rust
extern crate bio;
// use e.g. a pattern matching algorithm
use bio::pattern_matching::bndm::BNDM;
let pattern = b"GAAAA";
let text = b"ACGGCTAGAAAAGGCTAGAAAA";
let bndm = BNDM::new(pattern);
let matches = bndm.find_all(text);
```
For more information, please read the API documentation: https://johanneskoester.github.io/rust-bio
## Authors
* Johannes Köster (<johannes.koester@tu-dortmund.de>)
* Christopher Schröder (<christopher.schroeder@uni-due.de>)
* Peer Aramillo Irizar
The next name in this list could be you! If you are interested in joining the effort to build a general purpose Rust bioinformatics library, just send me an email, or issue a pull request with your first contribution.
## License
Licensed under the MIT license http://opensource.org/licenses/MIT. This project may not be copied, modified, or distributed except according to those terms.