1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118
// Copyright 2014-2016 Johannes Köster. // Licensed under the MIT license (http://opensource.org/licenses/MIT) // This file may not be copied, modified, or distributed // except according to those terms. //! # Rust-bio, a bioinformatics library for Rust. //! This library provides implementations of many algorithms and data structures //! that are useful for bioinformatics. //! All provided implementations are rigorously tested via continuous //! integration. //! For installation instructions and a general overview, visit //! https://rust-bio.github.io. //! //! Currently, rust-bio provides //! //! * most major pattern matching algorithms, //! * a convenient alphabet implementation, //! * pairwise alignment, //! * suffix arrays, //! * BWT and FM-Index, //! * FMD-Index for finding supermaximal exact matches, //! * a q-gram index, //! * an orf research algorithm, //! * a rank/select data structure, //! * FASTQ and FASTA and BED readers and writers, //! * helper functions for combinatorics and dealing with log probabilities, //! * an implementation of Hidden Markov Model and related algorithms. //! //! # Example //! //! ```rust //! use bio::alphabets; //! use bio::data_structures::suffix_array::suffix_array; //! use bio::data_structures::bwt::{bwt, less, Occ}; //! use bio::data_structures::fmindex::{FMIndex, FMIndexable}; //! //! let text = b"ACGGATGCTGGATCGGATCGCGCTAGCTA$"; //! let pattern = b"ACCG"; //! //! // Create an FM-Index for a given text. //! let alphabet = alphabets::dna::iupac_alphabet(); //! let sa = suffix_array(text); //! let bwt = bwt(text, &sa); //! let less = less(&bwt, &alphabet); //! let occ = Occ::new(&bwt, 3, &alphabet); //! let fmindex = FMIndex::new(&bwt, &less, &occ); //! //! let interval = fmindex.backward_search(pattern.iter()); //! let positions = interval.occ(&sa); //! ``` //! //! # Multithreaded Example //! //! ```rust //! use bio::alphabets; //! use bio::data_structures::suffix_array::suffix_array; //! use bio::data_structures::bwt::{bwt, less, Occ}; //! use bio::data_structures::fmindex::{FMIndex, FMIndexable}; //! use std::sync::Arc; //! use std::thread; //! //! let text = b"ACGGATGCTGGATCGGATCGCGCTAGCTA$"; //! let patterns = vec![b"ACCG", b"TGCT"]; //! //! // Create an FM-Index for a given text. //! let alphabet = alphabets::dna::iupac_alphabet(); //! let sa = suffix_array(text); //! let bwt = Arc::new(bwt(text, &sa)); //! let less = Arc::new(less(bwt.as_ref(), &alphabet)); //! let occ = Arc::new(Occ::new(bwt.as_ref(), 3, &alphabet)); //! let fmindex = Arc::new(FMIndex::new(bwt, less, occ)); //! //! // Spawn threads to perform backward searches for each interval //! let interval_calculators = patterns.into_iter().map(|pattern| { //! let fmindex = fmindex.clone(); //! thread::spawn(move || //! fmindex.backward_search(pattern.iter()) //! ) //! }).collect::<Vec<_>>(); //! //! // Loop through the results, extracting the positions array for each pattern //! for interval_calculator in interval_calculators { //! let positions = interval_calculator.join().unwrap().occ(&sa); //! } //! ``` //! //! Documentation and further examples for each module can be found in the module descriptions below. #[macro_use] extern crate approx; #[macro_use] extern crate custom_derive; #[macro_use] extern crate lazy_static; #[macro_use] extern crate newtype_derive; #[macro_use] extern crate quick_error; #[macro_use] extern crate serde_derive; #[macro_use] extern crate strum_macros; pub mod alignment; pub mod alphabets; pub mod data_structures; pub mod io; pub mod pattern_matching; pub mod scores; pub mod seq_analysis; pub mod stats; pub mod utils;