logo

Trait bio::data_structures::fmindex::FMIndexable

source · [−]
pub trait FMIndexable {
    fn occ(&self, r: usize, a: u8) -> usize;

    fn less(&self, a: u8) -> usize;

    fn bwt(&self) -> &BWT;

    fn backward_search<'b, P: Iterator<Item = &'b u8> + DoubleEndedIterator>(
        &self, 
        pattern: P
    ) -> BackwardSearchResult { ... }
}

Required methods

Get occurrence count of symbol a in BWT[..r+1].

Also known as

Provided methods

Perform backward search, yielding BackwardSearchResult enum that contains the suffix array interval denoting exact occurrences of the given pattern of length m in the text if it exists, or the suffix array interval denoting the exact occurrences of a maximal matching suffix of the given pattern if it does not exist. If none of the pattern can be matched, the BackwardSearchResult is Absent. Complexity: O(m).

Arguments
  • pattern - the pattern to search
Example
use bio::alphabets::dna;
use bio::data_structures::bwt::{bwt, less, Occ};
use bio::data_structures::fmindex::{BackwardSearchResult, FMIndex, FMIndexable};
use bio::data_structures::suffix_array::suffix_array;

let text = b"GCCTTAACATTATTACGCCTA$";
let alphabet = dna::n_alphabet();
let sa = suffix_array(text);
let bwt = bwt(text, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fm = FMIndex::new(&bwt, &less, &occ);

let pattern = b"TTA";
let bsr = fm.backward_search(pattern.iter());

let positions = match bsr {
    BackwardSearchResult::Complete(sai) => sai.occ(&sa),
    BackwardSearchResult::Partial(sai, _l) => sai.occ(&sa),
    BackwardSearchResult::Absent => Vec::<usize>::new()
};

assert_eq!(positions, [3, 12, 9]);

Implementors