Expand description
This crate provides types and traits for sequences of genomic data. Common encodings are provided and can be extended with the Codec trait.
Short sequences of fixed length (kmers) are given special attention.
§Quick start
Add bio-seq to Cargo.toml:
[dependencies]
bio-seq = "0.15"Iterating over the kmers of a sequence:
use bio_seq::prelude::*;
// The `dna!` macro packs a static sequence with 2-bits per symbol at compile time
let seq = dna!("ATACGATCGATCGATCGATCCGT");
// iterate over the 8-mers of the reverse complement
for kmer in seq.to_revcomp().kmers::<8>() {
println!("{kmer}");
}
// ACGGATCG
// CGGATCGA
// GGATCGAT
// GATCGATC
// ATCGATCG
// ...Sequences are analogous to rust’s string types and follow similar dereferencing conventions:
use bio_seq::prelude::*;
// Static sequences behave like static string literals:
let s: &'static str = "hello!";
let seq: &'static SeqSlice<Dna> = dna!("CGCTAGCTACGATCGCAT");
// Sequences can also be copied as `Kmer`s:
let kmer: Kmer<Dna, 18> = dna!("CGCTAGCTACGATCGCAT").try_into().unwrap();
// or with the kmer! macro:
let kmer = kmer!("CGCTAGCTACGATCGCAT");
// `Seq`s are allocated on the heap like `String`s are:
let s: String = "hello!".into();
let seq: Seq<Dna> = dna!("CGCTAGCTACGATCGCAT").into();
// Alternatively, a `Seq` can be fallibly encoded at runtime:
let seq: Seq<Dna> = "CGCTAGCTACGATCGCAT".try_into().unwrap();
// `&SeqSlice`s are analogous to `&str`, `String` slices:
let slice: &str = &s[1..3];
let seqslice: &SeqSlice<Dna> = &seq[2..4];Sequences can be read from popular third-party crates like noodles:
use bio_seq::prelude::*;
use noodles::fasta;
fn main() -> Result<(), Box<dyn std::error::Error>> {
let mut reader = fasta::io::reader::Builder.build_from_path("sequences.fa")?;
for result in reader.records() {
let record = result?;
let seq: Seq<Dna> = record.sequence().as_ref().try_into()?;
// ...
}
Ok(())
}
§Application examples
- Saving packed sequences to binary files
- Using noodles and counting kmers
- Codec benchmarks comparing memory use and entropy of lossy/degenerate encodings
§Philosophy
Many bioinformatics crates implement their own kmer packing logic. This effort began as a way to define types and traits that allow kmer code to be shared between projects. It quickly became apparent that a kmer type doesn’t make sense without being tightly coupled to a general type for sequences. The scope of this crate will be limited to operating on fixed and arbitrary length sequences with an emphasis on safety.
Some people like to engineer clever bit twiddling hacks to reverse complement a sequence and some people want to rapidly prototype succinct datastructures. Most people don’t want to worry about endianness. The strength of rust is that we can safely abstract the science from the engineering to work towards both objectives.
§Contributing
Contributions and suggestions are very much welcome. Check out the Roadmap to get started.
§Contents
- Codec: Coding/Decoding schemes for the symbols of a biological sequence
- Seq: A sequence of encoded symbols
- Kmer: A fixed size sequence of length
K - Derivable codecs: This crate offers utilities for defining your own bit-level encodings
§Sequences
Strings of encoded symbols are packed into Seq. Slicing, chunking, and windowing return SeqSlice. Seq<A: Codec> and &SeqSlice<A: Codec> are analogous to String and &str. As with the standard string types, Seqs are stored on the heap and implement Clone, SeqSlices are unsized views. Static SeqArrays are currently constructed by dna!/iupac! macros and should be dereferenced as &'static SeqSlice.
§Kmers
kmers are short sequences of length K that generally fit into a register (e.g. usize, or SIMD vector) and implement Copy. K is a compile-time constant.
All data is stored little-endian. This affects the order that sequences map to the integers:
use bio_seq::prelude::*;
for i in 0..=15 {
println!("{}: {}", i, Kmer::<Dna, 5>::from(i));
}0: AAAAA
1: CAAAA
2: GAAAA
3: TAAAA
4: ACAAA
5: CCAAA
6: GCAAA
7: TCAAA
...§Succinct encodings
A lookup table can be indexed in constant time by treating kmers directly as usize:
use bio_seq::prelude::*;
use std::marker::PhantomData;
struct Histogram<C: Codec, const K: usize> {
counts: Vec<usize>,
_p: PhantomData<C>,
}
impl<C: Codec, const K: usize> Histogram<C, K> {
fn new() -> Self {
Self {
counts: vec![0; 1 << (K * C::BITS as usize)],
_p: PhantomData,
}
}
fn add(&mut self, kmer: Kmer<C, K>) {
self.counts[usize::from(&kmer)] += 1;
}
fn get(&self, kmer: Kmer<C, K>) -> usize {
self.counts[usize::from(&kmer)]
}
}§Sketching
§Minimising
The 2-bit representation of nucleotides is ordered A < C < G < T. Sequences and kmers are stored little-endian and are ordered “colexicographically”. This means that AAAA < CAAA < GAAA < ... < AAAC < ... < TTTT:
use bio_seq::prelude::*;
let seq = dna!("GCTCGATCGTAAAAAATCGTATT");
let minimiser = seq.kmers::<8>().min().unwrap();
assert_eq!(minimiser, dna!("GTAAAAAA"));§Hashing and minimisers
Hash is implemented for sequence and kmer types so equal values of these types will hash identically:
use bio_seq::prelude::*;
use std::cmp::min;
use std::hash::{DefaultHasher, Hash, Hasher};
fn hash<T: Hash>(seq: T) -> u64 {
let mut hasher = DefaultHasher::new();
seq.hash(&mut hasher);
hasher.finish()
}
let seq = dna!("AGCGCTAGTCGTACTGCCGCATCGCTAGCGCT");
let (minimiser, min_hash) = seq
.kmers::<16>()
.map(|kmer| (kmer, hash(&kmer)))
.min_by_key(|&(_, hash)| hash)
.unwrap();
let (canonical_minimiser, canonical_hash) = seq
.kmers::<16>()
.map(|kmer| {
let canonical_hash = hash(min(kmer, kmer.to_revcomp()));
(kmer, canonical_hash)
})
.min_by_key(|&(_, hash)| hash)
.unwrap();Although it’s more efficient to minimise seq and seq.revcomp() separately.
§Codecs
The Codec trait describes the coding/decoding process for the symbols of a biological sequence. This trait can be derived procedurally. There are four built-in codecs:
-
codec::dna::Dna, Using the lexicographically ordered 2-bit representation -
codec::iupac::Iupac, IUPAC nucleotide ambiguity codes are represented with 4 bits. This automatically gives us membership semantics for bitwise operations. Logicaloris the union:use bio_seq::prelude::*; assert_eq!(iupac!("AS-GYTNA") | iupac!("ANTGCAT-"), iupac!("ANTGYWNA"));Logical
andis the intersection of two iupac sequences:use bio_seq::prelude::*; assert_eq!(iupac!("ACGTSWKM") & iupac!("WKMSTNNA"), iupac!("A----WKA")); -
codec::text::Dna, utf-8 strings that are read directly from common plain-text file formats can be treated as sequences. Additional logic can be defined to ensure that'a' == 'A'and for handling'N'. -
codec::amino::Amino, Amino acid sequences are represented with 6 bits. The representation of amino acids is designed to be easy to coerce from sequences of 2-bit encoded DNA.
The extra_codecs feature add two experimental families:
-
codec::masked, 4-bit nucleotide encoding with a soft mask (i.e. lowercase bases) -
codec::degenerate, 1-bit encodings that split nucleotides into two classes:WS: weak/strongRY: purine/pyrimidineMK: amino/ketone
§Defining new codecs
Custom codecs can be defined by implementing the Codec trait.
In simple cases the Codec trait can be derived from the variant names and discriminants of enum types:
use bio_seq::codec::Codec;
#[derive(Eq, Hash, Clone, Copy, Debug, PartialEq, Codec)]
#[repr(u8)]
pub enum Dna {
A = 0b00,
C = 0b01,
G = 0b10,
T = 0b11,
}Note that you need to explicitly provide a “discriminant” (e.g. 0b00) in the enum.
A #[bits(n)] attribute specifies how many bits the encoding requires per symbol. The maximum supported is 8. If this attribute isn’t specified then the optimal width will be chosen.
#[alt(...,)] and #[display('x')] attributes can be used to define alternative representations or display the item with a special character. Here is the definition for the stop codon in codec::Amino:
pub enum Amino {
#[display('*')] // print the stop codon as a '*'
#[alt(0b001011, 0b100011)] // TGA, TAG
X = 0b000011, // TAA (stop)
// ...
}§Sequence conversions
§Translation table traits
Translation tables provide methods for translating codons into amino acids.
Enable the translation feature in Cargo.toml:
[dependencies]
bio-seq = { version="0.15", features=["translation"] }Modules§
- codec
- Coding/Decoding trait for bit-packable enums representing sets of genomic symbols
- error
- kmer
- Encoded sequences of static length
- prelude
- seq
- Arbitrary length sequences of bit-packed genomic data
- translation
- Amino acid translation tables
Macros§
- __
bio_ seq_ count_ words - dna
- Static DNA sequences encoded at compile time
- iupac
- Static degenerate nucleotide codes encoded at compile time
- kmer
- Convenient compile time kmer constructor
Traits§
- Complement
- Complement
Mut - Nucleotide bases and sequences can be complemented
- Maskable
- Maskable
Mut - Some sequence types may be maskable
- Reverse
- Reverse
Complement - Reverse
Complement Mut - A reversible sequence that can be complemented can be reverse complemented
- Reverse
Mut - A reversible sequence