Expand description
Arbitrary length sequences of bit-packed genomic data, stored on the heap
Seq and SeqSlice are analogous to String and str. A Seq owns its data and a SeqSlice is a read-only window into a Seq.
use std::collections::HashMap;
use bio_seq::prelude::*;
use bio_seq::seq;
let reference: Seq<Dna> = dna!("ACGTTCGCATGCTACGACGATC").into();
let mut table: HashMap<Seq<Dna>, &SeqSlice<Dna>> = HashMap::new();
table.insert(dna!("ACGTT").into(), &reference[2..5]);
table.insert(dna!("ACACCCCC").into(), &reference[6..]);
// The query is a short window in the reference `Seq`
let query: &SeqSlice<Dna> = &reference[..5];
// The keys of the hashmap are `Seq`, but since `Seq` can be borrowed as a SeqSlice we can call `HashMap::get` on another slice.
if let Some(value) = table.get(query) {
// `SeqSlice` implements `Display`
println!("{value}");
}Modules§
Structs§
- A arbitrary length sequence of bit-packed symbols
- A lightweight, read-only window into part of a sequence
Traits§
- A reversible sequence of things that can be complemented can be reverse complemented