1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258
// Copyright 2021-2024 Jeff Knaggs
// Licensed under the MIT license (http://opensource.org/licenses/MIT)
// This file may not be copied, modified, or distributed
// except according to those terms.
//! Bit-packed and well-typed biological sequences
//!
//! - [seq]: A `Seq` is a heap allocated sequences of variable length that owns it's own data. A `SeqSlice` is a read-only window into a `Seq`.
//! - [mod@kmer]: `Kmer`s are short fixed length sequences. They generally implement `Copy` and can efficiently be passed on the stack.
//! - [codec]: Encodings of genomic data types to be packed into sequences.
//! - [translation]: Amino acid translation tables
//!
//! This crate is designed to facilitate common bioinformatics tasks,
//! incuding amino acid translation, k-mer minimisation and hashing, and
//! nucleotide sequence manipulation.
//!
//! Add `bio-seq` to `Cargo.toml`:
//!
//! ```toml
//! [dependencies]
//! bio-seq = "0.12"
//! ```
//!
//! ```rust
//! use bio_seq::prelude::*;
//!
//! let seq = dna!("ATACGATCGATCGATCGATCCGT");
//!
//! // iterate over the 8-mers of the reverse complement
//! for kmer in seq.revcomp().kmers::<8>() {
//! println!("{kmer}");
//! }
//!
//! // ACGGATCG
//! // CGGATCGA
//! // GGATCGAT
//! // GATCGATC
//! // ATCGATCG
//! // ...
//! ```
//!
//! The 4-bit encoding of IUPAC nucleotide ambiguity codes naturally represent a set of bases for each position (`0001`: `A`, `1111`: `N`, `0000`: `*`, ...):
//!
//! ```rust
//! use bio_seq::prelude::*;
//!
//! let seq = iupac!("AGCTNNCAGTCGACGTATGTA");
//! let pattern = iupac!("AYG");
//!
//! for slice in seq.windows(pattern.len()) {
//! if pattern.contains(slice) {
//! println!("{slice} matches pattern");
//! }
//! }
//!
//! // ACG matches pattern
//! // ATG matches pattern
//! ```
//!
//! Logical `or` is the union:
//!
//! ```rust
//! # use bio_seq::prelude::*;
//! assert_eq!(iupac!("AS-GYTNA") | iupac!("ANTGCAT-"), iupac!("ANTGYWNA"));
//! ```
//!
//! Logical `and` is the intersection of two iupac sequences:
//!
//! ```rust
//! # use bio_seq::prelude::*;
//! assert_eq!(iupac!("ACGTSWKM") & iupac!("WKMSTNNA"), iupac!("A----WKA"));
//! ```
use bitvec::prelude::*;
type Order = Lsb0;
type Bs = BitSlice<u8, Order>;
type Bv = BitVec<u8, Order>;
type Ba = BitArray<usize, Order>;
#[macro_use]
pub mod codec;
pub mod error;
pub mod kmer;
pub mod seq;
pub mod translation;
pub mod prelude {
pub use crate::codec::amino::Amino;
pub use crate::codec::dna::Dna;
pub use crate::codec::iupac::Iupac;
pub use crate::codec::{Codec, Complement};
pub use crate::kmer::Kmer;
pub use crate::seq::{ReverseComplement, Seq, SeqSlice};
pub use crate::{amino, dna, iupac, kmer};
pub use crate::translation;
pub use core::str::FromStr;
pub use crate::error::ParseBioError;
}
#[cfg(test)]
mod tests {
use crate::codec::dna::Dna::{A, C, G, T};
use crate::prelude::*;
#[test]
fn alt_repr() {
assert_eq!(iupac!("-").nth(0), Iupac::X);
}
#[test]
fn into_usize() {
let a: usize = dna!("ACGT").into();
assert_eq!(a, 0b11_10_01_00);
let b: usize = dna!("CGCG").into();
assert_eq!(b, 0b10_01_10_01);
let c: usize = Seq::from(&vec![T, T]).into();
assert_eq!(c, 0b11_11);
let d: usize = Seq::<Dna>::from_str("TCA").unwrap().into();
assert_eq!(d, 0b00_01_11);
let e: usize = Seq::<Dna>::from_str("TGA").unwrap().into();
assert_eq!(e, 0b00_10_11);
let f: usize = Seq::from(&vec![C, G, T, A, C, G, A, T]).into();
assert_eq!(f, 0b11_00_10_01_00_11_10_01);
let g: usize = Seq::from(&vec![A]).into();
assert_eq!(g, 0b00);
}
#[test]
fn test_display_aminos() {
let a: Seq<Amino> = Seq::from_str("DCMNLKG*HI").unwrap();
assert_eq!(format!("{a}"), "DCMNLKG*HI");
}
#[test]
fn test_display_dna() {
let seq = Seq::from(&vec![A, C, G, T, T, A, T, C]);
assert_eq!(format!("{}", &seq), "ACGTTATC");
assert_eq!(format!("{}", dna!("ACGT")), "ACGT");
}
#[test]
fn iterate_bases() {
let seq = dna!("ACGTACGT");
assert_eq!(
seq.into_iter().collect::<Vec<Dna>>(),
vec![A, C, G, T, A, C, G, T]
);
}
#[test]
fn from_string() {
let seq = Seq::<Dna>::from_str("ACGTACGT").unwrap();
assert_eq!(
seq.into_iter().collect::<Vec<Dna>>(),
vec![A, C, G, T, A, C, G, T]
);
}
#[test]
fn rev_seq() {
let seq = dna!("ACGTACGT");
assert_eq!(
seq.rev().collect::<Vec<Dna>>(),
vec![T, G, C, A, T, G, C, A]
);
assert_eq!(
iupac!("GN-").rev().collect::<Vec<Iupac>>(),
vec![Iupac::X, Iupac::N, Iupac::G]
);
assert_eq!(
amino!("DCMNLKGHI").rev().collect::<Vec<Amino>>(),
vec![
Amino::I,
Amino::H,
Amino::G,
Amino::K,
Amino::L,
Amino::N,
Amino::M,
Amino::C,
Amino::D
]
);
}
#[test]
fn iterate_kmers() {
let seq = dna!("ACGTAAGGGG");
for (kmer, answer) in seq
.kmers::<4>()
.zip(["ACGT", "CGTA", "GTAA", "TAAG", "AAGG", "AGGG", "GGGG"])
{
assert_eq!(format!("{}", kmer), answer);
}
}
#[test]
fn iterate_kmer8() {
let seq = dna!("AAAACCCCGGGG");
for (kmer, answer) in seq
.kmers::<8>()
.zip(["AAAACCCC", "AAACCCCG", "AACCCCGG", "ACCCCGGG", "CCCCGGGG"])
{
assert_eq!(format!("{}", kmer), answer);
}
}
#[test]
fn iterate_kmer4() {
let seq = dna!("AAAACCCCGGGGTTTT");
for (kmer, answer) in seq.kmers::<4>().zip([
"AAAA", "AAAC", "AACC", "ACCC", "CCCC", "CCCG", "CCGG", "CGGG", "GGGG", "GGGT", "GGTT",
"GTTT", "TTTT",
]) {
assert_eq!(format!("{}", kmer), answer);
}
}
#[test]
fn iupac_bitwise_ops() {
assert_eq!(iupac!("AS-GYTNA") | iupac!("ANTGCAT-"), iupac!("ANTGYWNA"));
assert_eq!(iupac!("ACGTSWKM") & iupac!("WKMSTNNA"), iupac!("A----WKA"));
}
#[test]
fn nth_chars() {
assert_eq!(iupac!("ACGTRYSWKMBDHVN-").nth(0), Iupac::A);
assert_ne!(iupac!("ACGTRYSWKMBDHVN-").nth(0), Iupac::C);
assert_eq!(iupac!("ACGTRYSWKMBDHVN-").nth(15), Iupac::X);
assert_eq!(iupac!("ACGTRYSWKMBDHVN-").nth(3), Iupac::from(Dna::T));
assert_ne!(iupac!("ACGTRYSWKMBDHVN-").nth(3), Iupac::from(Dna::G));
assert_eq!(amino!("DCMNLKGHI").nth(1), Amino::C);
assert_ne!(amino!("DCMNLKGHI").nth(7), Amino::I);
}
#[test]
fn colexicographic_order() {
for (i, e) in ["AA", "CA", "GA", "TA", "AC", "CC", "GC", "TC"]
.iter()
.enumerate()
{
assert_eq!(format!("{}", Kmer::<Dna, 2>::from(i)), format!("{}", e));
assert_eq!(Kmer::<Dna, 2>::from(i), *e);
}
}
}