Crate aardvark_bio 

Aardvark-bio

Aardvark-bio is the underlying library that supports the Aardvark command line tool. The library provides the core functionality for comparing and merging variant calls. The waffle solver contains the main entry point for the compare command, with example usage below:

Example compare usage

use aardvark_bio::data_types::compare_region::CompareRegion;
use aardvark_bio::data_types::coordinates::Coordinates;
use aardvark_bio::data_types::phase_enums::PhasedZygosity;
use aardvark_bio::data_types::variants::Variant;
use aardvark_bio::data_types::summary_metrics::{SummaryGtMetrics, SummaryMetrics};
use aardvark_bio::data_types::variant_metrics::{VariantMetrics, VariantSource};
use aardvark_bio::waffle_solver::{CompareConfig, solve_compare_region};
use rust_lib_reference_genome::reference_genome::ReferenceGenome;

// create a basic reference genome in memory
let mut reference_genome = ReferenceGenome::empty_reference();
reference_genome.add_contig(
    "mock_chr1".to_string(), "ACCGTTACCAGGACTTGACAAACCG"
).unwrap();

// create a problem to solve; this is a simple SNV in the middle of the sequence
let coordinates = Coordinates::new("mock_chr1".to_string(), 0, 10); // ACCGTTACCA
let truth_variants = vec![
    Variant::new_snv(0, 2, b"C".to_vec(), b"G".to_vec()).unwrap()
];
let truth_zygosity = vec![
    PhasedZygosity::PhasedHet10
];

// create a query set that is the same as the truth set
let query_variants = truth_variants.clone();
let query_zygosity = truth_zygosity.clone();

// put it all into a CompareRegion object for the solver
let problem = CompareRegion::new(
    0, coordinates, truth_variants, truth_zygosity, query_variants, query_zygosity
).unwrap();

// solve the problem
let compare_config = CompareConfig::default();
let result = solve_compare_region(&problem, &reference_genome, compare_config, None).unwrap();

// check the results
assert_eq!(result.total_ed(), 0); // should be exact paths
let group_metrics = result.group_metrics();
assert_eq!(*group_metrics.joint_metrics().gt(), SummaryGtMetrics::new(1, 0, 1, 0, 0, 0));
assert_eq!(*group_metrics.joint_metrics().hap(), SummaryMetrics::new(1, 0, 1, 0));
assert_eq!(*group_metrics.joint_metrics().basepair(), SummaryMetrics::new(2*1, 0, 2*1, 0));
assert_eq!(result.truth_variant_data(), &[VariantMetrics::new(VariantSource::Truth, 1, 1).unwrap()]);
assert_eq!(result.query_variant_data(), &[VariantMetrics::new(VariantSource::Query, 1, 1).unwrap()]);

// check the sequences also
let sequence_bundle = result.sequence_bundle().unwrap();
assert_eq!(&sequence_bundle.ref_seq,    "ACCGTTACCA");
assert_eq!(&sequence_bundle.truth_seq1, "ACGGTTACCA");
assert_eq!(&sequence_bundle.query_seq1, "ACGGTTACCA");
assert_eq!(&sequence_bundle.truth_seq2, "ACCGTTACCA");
assert_eq!(&sequence_bundle.query_seq2, "ACCGTTACCA");

Modules

cli

Command line interface functionality that is specific to Aardvark

data_types

Contains various shared data types

dwfa

Contains Dynamic WFA implementations that enable fast quantification of edit distance between two dynamic sequences

exact_gt_optimizer

Tooling for optimizing the exact GT category

merge_solver

Contains the core logic for identifying regions to merge

parsing

Tooling for parsing input files into meaningful structs / data

query_optimizer

Optimizes query sequence relative to truth

util

Contains generic utility functions

waffle_solver

Contains the entry point for evaluating truth and query variants relative to each other

writers

All output writers