Expand description
§faiquery
faiquery
is a library for querying FASTA files using the FAI index format.
It is designed to be fast and memory efficient, and is suitable for use in
high-throughput applications.
It keeps a memory-mapped index of the FASTA file, and uses this to query the file on demand using interval queries.
§Mutability
The IndexedFasta
has the option of keeping an internal buffer for
reading. This buffer is reused for all queries, and is cleared after each
query. This is the default behaviour.
It will remove all newlines from the resulting queries, and return the
resulting sequence as a &[u8]
.
However, if you need to keep the newlines, or if you need to keep the
memory usage low then you can use the query_buffer
method instead. This
will return a &[u8]
directly from the memory map and avoid copying the
sequence into a buffer.
This will not remove newlines from the resulting sequence.
§Example
Here is an example fasta file:
§example.fa
>chr1
ACCTACGATCGACTGATCGTAGCTAGCT
CATCGATCGTACGGACGATCGATCGGTT
CACACCGGGCATGACTGATCGGGGGCCC
ACGTGTGTGCAGCGCGCGGCGCGCGCGG
>chr2
TTTTGATCGATCGGCGGGCGCGCGCGGC
CAGATTCGGGCGCGATTATATATTAGCT
CGACGGCGACTCGAGCTACACGTCGGGC
GCGAGCGGGACGCGCGGCGCGCGCGGCC
AAAAAAATTTTTATATATTATTACGCGC
CGACTCAGTCGACTGGGGGCGCGCGCGC
AAACCACA
and its corresponding index file:
§example.fa.fai
chr1 112 6 28 29
chr2 176 128 28 29
§Querying the FASTA file
Let’s show the default behavior which includes keeping an internal buffer
and requires a mutable IndexedFasta
object.
use faiquery::{FastaIndex, IndexedFasta};
use anyhow::Result;
let index = FastaIndex::from_filepath("example_data/example.fa.fai")
.expect("Could not read index file");
let mut faidx = IndexedFasta::new(index, "example_data/example.fa")
.expect("Could not read FASTA file");
// Query the first 10 bases of chr1
let seq = faidx.query("chr1", 0, 10).unwrap();
assert_eq!(seq, b"ACCTACGATC");
// Query the first 10 bases of chr2
let seq = faidx.query("chr2", 0, 10).unwrap();
assert_eq!(seq, b"TTTTGATCGA");
// Query the first 40 bases of chr1
let seq = faidx.query("chr1", 0, 40).unwrap();
// The resulting sequence is 40 bases long
assert_eq!(seq.len(), 40);
// The resulting sequence has no newlines
let num_newlines = seq.iter().filter(|&&b| b == b'\n').count();
assert_eq!(num_newlines, 0);
§Querying the FASTA file immutably
Let’s now show the immutable behavior which does not keep an internal
buffer and does not require a mutable IndexedFasta
object.
use faiquery::{FastaIndex, IndexedFasta};
use anyhow::Result;
let index = FastaIndex::from_filepath("example_data/example.fa.fai")
.expect("Could not read index file");
let faidx = IndexedFasta::new(index, "example_data/example.fa")
.expect("Could not read FASTA file");
// Query the first 10 bases of chr1
let seq = faidx.query_buffer("chr1", 0, 10).unwrap();
assert_eq!(seq, b"ACCTACGATC");
// Query the first 10 bases of chr2
let seq = faidx.query_buffer("chr2", 0, 10).unwrap();
assert_eq!(seq, b"TTTTGATCGA");
// Query the first 40 bases of chr1
let seq = faidx.query_buffer("chr1", 0, 40).unwrap();
// The resulting sequence is 41 characters long
// This is because 1 newline is included
assert_eq!(seq.len(), 41);
// The resulting sequence has 1 newline
let num_newlines = seq.iter().filter(|&&b| b == b'\n').count();
assert_eq!(num_newlines, 1);
Structs§
- Fasta
Index - The
FastaIndex
struct represents a FAI index file. A FASTA index. - Index
Entry - The
IndexEntry
struct represents a single entry in a FAI index file. A FASTA index entry. - Indexed
Fasta - The
IndexedFasta
struct represents a FASTA file that has been indexed using the FAI format. An indexed FASTA file.