1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845
// Copyright 2014-2016 Johannes Köster, Taylor Cramer.
// Licensed under the MIT license (http://opensource.org/licenses/MIT)
// This file may not be copied, modified, or distributed
// except according to those terms.
//! The [Full-text index in Minute space index (FM-index)](https://doi.org/10.1109/SFCS.2000.892127) and
//! the FMD-Index for finding suffix array intervals matching a given pattern in linear time.
//!
//! # Examples
//!
//! ## Generate
//!
//! ```
//! use bio::alphabets::dna;
//! use bio::data_structures::bwt::{bwt, less, Occ};
//! use bio::data_structures::fmindex::{FMIndex, FMIndexable};
//! use bio::data_structures::suffix_array::suffix_array;
//!
//! let text = b"GCCTTAACATTATTACGCCTA$";
//! let alphabet = dna::n_alphabet();
//! let sa = suffix_array(text);
//! let bwt = bwt(text, &sa);
//! let less = less(&bwt, &alphabet);
//! let occ = Occ::new(&bwt, 3, &alphabet);
//! let fm = FMIndex::new(&bwt, &less, &occ);
//! ```
//!
//! ## Enclose in struct
//!
//! `FMIndex` was designed to not forcibly own the BWT and auxiliary data structures.
//! It can take a reference (`&`), owned structs or any of the more complex pointer types.
//!
//! ```
//! use bio::alphabets::dna;
//! use bio::data_structures::bwt::{bwt, less, Less, Occ, BWT};
//! use bio::data_structures::fmindex::{FMIndex, FMIndexable};
//! use bio::data_structures::suffix_array::suffix_array;
//! use bio::utils::TextSlice;
//!
//! pub struct Example {
//! fmindex: FMIndex<BWT, Less, Occ>,
//! }
//!
//! impl Example {
//! pub fn new(text: TextSlice) -> Self {
//! let alphabet = dna::n_alphabet();
//! let sa = suffix_array(text);
//! let bwt = bwt(text, &sa);
//! let less = less(&bwt, &alphabet);
//! let occ = Occ::new(&bwt, 3, &alphabet);
//! let fm = FMIndex::new(bwt, less, occ);
//! Example { fmindex: fm }
//! }
//! }
//! ```
use std::borrow::Borrow;
use std::iter::DoubleEndedIterator;
use crate::alphabets::dna;
use crate::data_structures::bwt::{Less, Occ, BWT};
use crate::data_structures::suffix_array::SuffixArray;
use std::mem::swap;
/// A suffix array interval.
#[derive(
Default, Copy, Clone, Eq, PartialEq, Ord, PartialOrd, Hash, Debug, Serialize, Deserialize,
)]
pub struct Interval {
pub lower: usize,
pub upper: usize,
}
impl Interval {
pub fn occ<SA: SuffixArray>(&self, sa: &SA) -> Vec<usize> {
(self.lower..self.upper)
.map(|pos| sa.get(pos).expect("Interval out of range of suffix array"))
.collect()
}
}
/// This enum represents the potential result states
/// from a backward_search in the fm index. The
/// potential variants of the enum are:
/// Complete(Interval) — the query matched completely. The interval is the
/// range of suffix array indices matching the query string.
/// Partial(Intarval, usize) - some suffix of the query matched, but not the whole query.
/// The interval returned is the range of suffix array indices for the maximal
/// matching suffix, and the `usize` is the length of the maximal matching suffix.
/// Absent - None suffix of the pattern matched in the text.
#[derive(Copy, Clone, Eq, PartialEq, Ord, PartialOrd, Hash, Debug, Serialize, Deserialize)]
pub enum BackwardSearchResult {
Complete(Interval),
Partial(Interval, usize),
Absent,
}
pub trait FMIndexable {
/// Get occurrence count of symbol a in BWT[..r+1].
fn occ(&self, r: usize, a: u8) -> usize;
/// Also known as
fn less(&self, a: u8) -> usize;
fn bwt(&self) -> &BWT;
/// Perform backward search, yielding `BackwardSearchResult` enum that
/// contains the suffix array interval denoting exact occurrences of the given pattern
/// of length m in the text if it exists, or the suffix array interval denoting the
/// exact occurrences of a maximal matching suffix of the given pattern if it does
/// not exist. If none of the pattern can be matched, the `BackwardSearchResult` is
/// `Absent`.
/// Complexity: O(m).
///
/// # Arguments
///
/// * `pattern` - the pattern to search
///
/// # Example
///
/// ```
/// use bio::alphabets::dna;
/// use bio::data_structures::bwt::{bwt, less, Occ};
/// use bio::data_structures::fmindex::{BackwardSearchResult, FMIndex, FMIndexable};
/// use bio::data_structures::suffix_array::suffix_array;
///
/// let text = b"GCCTTAACATTATTACGCCTA$";
/// let alphabet = dna::n_alphabet();
/// let sa = suffix_array(text);
/// let bwt = bwt(text, &sa);
/// let less = less(&bwt, &alphabet);
/// let occ = Occ::new(&bwt, 3, &alphabet);
/// let fm = FMIndex::new(&bwt, &less, &occ);
///
/// let pattern = b"TTA";
/// let bsr = fm.backward_search(pattern.iter());
///
/// let positions = match bsr {
/// BackwardSearchResult::Complete(sai) => sai.occ(&sa),
/// BackwardSearchResult::Partial(sai, _l) => sai.occ(&sa),
/// BackwardSearchResult::Absent => Vec::<usize>::new(),
/// };
///
/// assert_eq!(positions, [3, 12, 9]);
/// ```
fn backward_search<'b, P: Iterator<Item = &'b u8> + DoubleEndedIterator>(
&self,
pattern: P,
) -> BackwardSearchResult {
let (mut l, mut r) = (0, self.bwt().len() - 1);
// to keep track of the last "valid" search interval if
// there is any valid suffix match.
let (mut pl, mut pr) = (l, r);
// the length of the suffix we have been able to match
// successfully
let mut matched_len = 0;
// track if we exit early or not due to an empty
// search interval.
let mut complete_match = true;
for &a in pattern.rev() {
let less = self.less(a);
pl = l;
pr = r;
l = less + if l > 0 { self.occ(l - 1, a) } else { 0 };
r = less + self.occ(r, a) - 1;
// The symbol was not found if we end up with an empty interval.
// Terminate the LF-mapping process. In this case, also mark that
// we do not have a complete match.
if l > r {
complete_match = false;
break;
}
matched_len += 1;
}
// if we matched at least 1 character
if matched_len > 0 {
// if we matched the full pattern length we
// have a complete match
if complete_match {
BackwardSearchResult::Complete(Interval {
lower: l,
upper: r + 1,
})
} else {
// if we matched less than the full pattern length, we have
// a partial suffix match
BackwardSearchResult::Partial(
Interval {
lower: pl,
upper: pr + 1,
},
matched_len,
)
}
} else {
// if we matched nothing we have an absent result
BackwardSearchResult::Absent
}
}
}
/// The Fast Index in Minute space (FM-Index, Ferragina and Manzini, 2000) for finding suffix array
/// intervals matching a given pattern.
#[derive(
Default, Copy, Clone, Eq, PartialEq, Ord, PartialOrd, Hash, Debug, Serialize, Deserialize,
)]
pub struct FMIndex<DBWT: Borrow<BWT>, DLess: Borrow<Less>, DOcc: Borrow<Occ>> {
bwt: DBWT,
less: DLess,
occ: DOcc,
}
impl<DBWT: Borrow<BWT>, DLess: Borrow<Less>, DOcc: Borrow<Occ>> FMIndexable
for FMIndex<DBWT, DLess, DOcc>
{
fn occ(&self, r: usize, a: u8) -> usize {
self.occ.borrow().get(self.bwt.borrow(), r, a)
}
fn less(&self, a: u8) -> usize {
self.less.borrow()[a as usize]
}
/// Provide a reference to the underlying BWT.
fn bwt(&self) -> &BWT {
self.bwt.borrow()
}
}
impl<DBWT: Borrow<BWT>, DLess: Borrow<Less>, DOcc: Borrow<Occ>> FMIndex<DBWT, DLess, DOcc> {
/// Construct a new instance of the FM index.
///
/// # Arguments
///
/// * `bwt` - the BWT
/// * `less` - the less array of the BWT
/// * `occ` - the occurence array of the BWT
pub fn new(bwt: DBWT, less: DLess, occ: DOcc) -> Self {
FMIndex { bwt, less, occ }
}
}
/// A bi-interval on suffix array of the forward and reverse strand of a DNA text.
#[derive(
Default, Copy, Clone, Eq, PartialEq, Ord, PartialOrd, Hash, Debug, Serialize, Deserialize,
)]
pub struct BiInterval {
lower: usize,
lower_rev: usize,
size: usize,
match_size: usize,
}
impl BiInterval {
pub fn forward(&self) -> Interval {
Interval {
upper: self.lower + self.size,
lower: self.lower,
}
}
pub fn revcomp(&self) -> Interval {
Interval {
upper: self.lower_rev + self.size,
lower: self.lower_rev,
}
}
fn swapped(&self) -> BiInterval {
BiInterval {
lower: self.lower_rev,
lower_rev: self.lower,
size: self.size,
match_size: self.match_size,
}
}
}
/// The FMD-Index for linear time search of supermaximal exact matches on forward and reverse
/// strand of DNA texts (Li, 2012).
#[derive(
Default, Copy, Clone, Eq, PartialEq, Ord, PartialOrd, Hash, Debug, Serialize, Deserialize,
)]
pub struct FMDIndex<DBWT: Borrow<BWT>, DLess: Borrow<Less>, DOcc: Borrow<Occ>> {
fmindex: FMIndex<DBWT, DLess, DOcc>,
}
impl<DBWT: Borrow<BWT>, DLess: Borrow<Less>, DOcc: Borrow<Occ>> FMIndexable
for FMDIndex<DBWT, DLess, DOcc>
{
fn occ(&self, r: usize, a: u8) -> usize {
self.fmindex.occ(r, a)
}
fn less(&self, a: u8) -> usize {
self.fmindex.less(a)
}
/// Provide a reference to the underlying BWT.
fn bwt(&self) -> &BWT {
self.fmindex.bwt()
}
}
impl<DBWT: Borrow<BWT>, DLess: Borrow<Less>, DOcc: Borrow<Occ>> From<FMIndex<DBWT, DLess, DOcc>>
for FMDIndex<DBWT, DLess, DOcc>
{
/// Construct a new instance of the FMD index (see Heng Li (2012) Bioinformatics).
/// This expects a BWT that was created from a text over the DNA alphabet with N
/// (`alphabets::dna::n_alphabet()`) consisting of the
/// concatenation with its reverse complement, separated by the sentinel symbol `$`.
/// I.e., let T be the original text and R be its reverse complement.
/// Then, the expected text is T$R$. Further, multiple concatenated texts are allowed, e.g.
/// T1$R1$T2$R2$T3$R3$.
fn from(fmindex: FMIndex<DBWT, DLess, DOcc>) -> FMDIndex<DBWT, DLess, DOcc> {
let mut alphabet = dna::n_alphabet();
alphabet.insert(b'$');
assert!(
alphabet.is_word(fmindex.bwt()),
"Expecting BWT over the DNA alphabet (including N) with the sentinel $."
);
FMDIndex { fmindex }
}
}
impl<DBWT: Borrow<BWT>, DLess: Borrow<Less>, DOcc: Borrow<Occ>> FMDIndex<DBWT, DLess, DOcc> {
/// Find supermaximal exact matches (of length >= l) of given pattern that overlap position i in the pattern.
/// Complexity O(m) with pattern of length m.
///
/// # Example
///
/// ```
/// use bio::alphabets::dna;
/// use bio::data_structures::bwt::{bwt, less, Occ};
/// use bio::data_structures::fmindex::{FMDIndex, FMIndex};
/// use bio::data_structures::suffix_array::suffix_array;
///
/// let text = b"ATTC$GAAT$";
/// let alphabet = dna::n_alphabet();
/// let sa = suffix_array(text);
/// let bwt = bwt(text, &sa);
/// let less = less(&bwt, &alphabet);
/// let occ = Occ::new(&bwt, 3, &alphabet);
/// let fm = FMIndex::new(&bwt, &less, &occ);
/// let fmdindex = FMDIndex::from(fm);
///
/// let pattern = b"ATT";
/// let intervals = fmdindex.smems(pattern, 2, 0);
///
/// let forward_positions = intervals[0].0.forward().occ(&sa);
/// let revcomp_positions = intervals[0].0.revcomp().occ(&sa);
/// let pattern_position = intervals[0].1;
/// let smem_len = intervals[0].2;
///
/// assert_eq!(forward_positions, [0]);
/// assert_eq!(revcomp_positions, [6]);
/// assert_eq!(pattern_position, 0);
/// assert_eq!(smem_len, 3);
/// ```
pub fn smems(&self, pattern: &[u8], i: usize, l: usize) -> Vec<(BiInterval, usize, usize)> {
let curr = &mut Vec::new(); // pairs (biinterval, current match length)
let prev = &mut Vec::new(); // """
let mut matches = Vec::new(); // triples (biinterval, position on pattern, smem length)
let mut match_len = 0;
let mut interval = self.init_interval_with(pattern[i]);
if interval.size != 0 {
match_len += 1;
}
for &a in pattern[i + 1..].iter() {
// forward extend interval
let forward_interval = self.forward_ext(&interval, a);
// if size changed, add last interval to list
if interval.size != forward_interval.size {
curr.push((interval, match_len));
}
// if new interval size is zero, stop, as no further forward extension is possible
if forward_interval.size == 0 {
break;
}
interval = forward_interval;
match_len += 1;
}
// add the last non-zero interval
curr.push((interval, match_len));
// reverse intervals such that longest comes first
curr.reverse();
swap(curr, prev);
let mut j = pattern.len() as isize;
for k in (-1..i as isize).rev() {
let a = if k == -1 { b'$' } else { pattern[k as usize] };
curr.clear();
// size of the last confirmed interval
let mut last_size = -1;
for (interval, match_len) in prev.iter() {
// backward extend interval
let forward_interval = self.backward_ext(interval, a);
if (forward_interval.size == 0 || k == -1) &&
// interval could not be extended further
// if no interval has been extended this iteration,
// interval is maximal and can be added to the matches
curr.is_empty() && k < j &&
match_len >= &l
{
j = k;
matches.push((*interval, (k + 1) as usize, *match_len));
}
// add _interval to curr (will be further extended next iteration)
if forward_interval.size != 0 && forward_interval.size as isize != last_size {
last_size = forward_interval.size as isize;
curr.push((forward_interval, match_len + 1));
}
}
if curr.is_empty() {
break;
}
swap(curr, prev);
}
matches
}
/// Find all supermaximal exact matches (of length >= l) of given pattern.
/// Complexity O(m^2) with pattern of length m.
///
/// # Example
///
/// ```
/// use bio::alphabets::dna;
/// use bio::data_structures::bwt::{bwt, less, Occ};
/// use bio::data_structures::fmindex::{FMDIndex, FMIndex};
/// use bio::data_structures::suffix_array::suffix_array;
///
/// let text = b"ATTCGGGG$CCCCGAAT$";
/// let alphabet = dna::n_alphabet();
/// let sa = suffix_array(text);
/// let bwt = bwt(text, &sa);
/// let less = less(&bwt, &alphabet);
/// let occ = Occ::new(&bwt, 3, &alphabet);
/// let fm = FMIndex::new(&bwt, &less, &occ);
/// let fmdindex = FMDIndex::from(fm);
///
/// let pattern = b"ATTGGGG";
/// let intervals = fmdindex.all_smems(pattern, 0);
/// assert_eq!(intervals.len(), 2);
///
/// let solutions = vec![[0, 14, 0, 3], [4, 9, 3, 4]];
/// for (i, interval) in intervals.iter().enumerate() {
/// let forward_positions = interval.0.forward().occ(&sa);
/// let revcomp_positions = interval.0.revcomp().occ(&sa);
/// let pattern_position = interval.1;
/// let smem_len = interval.2;
/// assert_eq!(
/// [
/// forward_positions[0],
/// revcomp_positions[0],
/// pattern_position,
/// smem_len
/// ],
/// solutions[i]
/// );
/// }
/// ```
pub fn all_smems(&self, pattern: &[u8], l: usize) -> Vec<(BiInterval, usize, usize)> {
let mut smems = Vec::new();
let mut i0 = 0;
while i0 < pattern.len() {
let mut curr_smems = self.smems(pattern, i0, l);
let mut next_i0 = i0 + 1; // this always works since:
// if we have a SMEM overlapping i0, it is at least 1bp long.
// If we don't have a smem, then we'll reiterate from i0+1
for (_, p, l) in curr_smems.iter() {
if p + l > next_i0 {
next_i0 = p + l;
}
}
i0 = next_i0;
smems.append(&mut curr_smems);
}
smems
}
/// Initialize interval with given start character.
pub fn init_interval_with(&self, a: u8) -> BiInterval {
let comp_a = dna::complement(a);
let lower = self.fmindex.less(a);
BiInterval {
lower,
lower_rev: self.fmindex.less(comp_a),
size: self.fmindex.less(a + 1) - lower,
match_size: 1,
}
}
/// Initialize interval for empty pattern. The interval points at the whole suffix array.
pub fn init_interval(&self) -> BiInterval {
BiInterval {
lower: 0,
lower_rev: 0,
size: self.fmindex.bwt.borrow().len(),
match_size: 0,
}
}
/// Backward extension of given interval with given character.
pub fn backward_ext(&self, interval: &BiInterval, a: u8) -> BiInterval {
let mut s = 0;
let mut o = 0;
let mut l = interval.lower_rev;
// Interval [l(c(aP)), u(c(aP))] is a subinterval of [l(c(P)), u(c(P))] for each a,
// starting with the lexicographically smallest ($),
// then c(T) = A, c(G) = C, c(C) = G, N, c(A) = T, ...
// Hence, we calculate lower revcomp bounds by iterating over
// symbols and updating from previous one.
for &b in b"$TGCNAtgcna".iter() {
l += s;
o = if interval.lower == 0 {
0
} else {
self.fmindex.occ(interval.lower - 1, b)
};
// calculate size
s = self.fmindex.occ(interval.lower + interval.size - 1, b) - o;
if b == a {
break;
}
}
// calculate lower bound
let k = self.fmindex.less(a) + o;
BiInterval {
lower: k,
lower_rev: l,
size: s,
match_size: interval.match_size + 1,
}
}
pub fn forward_ext(&self, interval: &BiInterval, a: u8) -> BiInterval {
let comp_a = dna::complement(a);
self.backward_ext(&interval.swapped(), comp_a).swapped()
}
/// Construct a new instance of the FMD index (see Heng Li (2012) Bioinformatics)
/// without checking whether the text is over the DNA alphabet with N.
/// This expects a BWT that was created from a text over the DNA alphabet with N
/// (`alphabets::dna::n_alphabet()`) consisting of the
/// concatenation with its reverse complement, separated by the sentinel symbol `$`.
/// I.e., let T be the original text and R be its reverse complement.
/// Then, the expected text is T$R$. Further, multiple concatenated texts are allowed, e.g.
/// T1$R1$T2$R2$T3$R3$.
/// It is unsafe to construct an FMD index from an FM index that is not built on the DNA alphabet.
pub unsafe fn from_fmindex_unchecked(
fmindex: FMIndex<DBWT, DLess, DOcc>,
) -> FMDIndex<DBWT, DLess, DOcc> {
FMDIndex { fmindex }
}
}
#[cfg(test)]
mod tests {
use super::*;
use crate::alphabets::dna;
use crate::data_structures::bwt::{bwt, less, Occ};
use crate::data_structures::suffix_array::suffix_array;
#[test]
fn test_fmindex() {
let text = b"GCCTTAACATTATTACGCCTA$";
let alphabet = dna::n_alphabet();
let sa = suffix_array(text);
let bwt = bwt(text, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fm = FMIndex::new(&bwt, &less, &occ);
let pattern = b"TTA";
let sai = fm.backward_search(pattern.iter());
let positions = match sai {
BackwardSearchResult::Complete(saint) => saint.occ(&sa),
BackwardSearchResult::Partial(saint, _l) => saint.occ(&sa),
BackwardSearchResult::Absent => Vec::<usize>::new(),
};
assert_eq!(positions, [3, 12, 9]);
}
#[test]
fn test_fmindex_not_found() {
let text = b"TCCTTAACATTATTACTCCTA$";
let alphabet = dna::n_alphabet();
let sa = suffix_array(text);
let bwt = bwt(text, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fm = FMIndex::new(&bwt, &less, &occ);
let pattern = b"TTG";
let sai = fm.backward_search(pattern.iter());
let positions = match sai {
BackwardSearchResult::Complete(saint) => saint.occ(&sa),
BackwardSearchResult::Partial(saint, _l) => saint.occ(&sa),
BackwardSearchResult::Absent => Vec::<usize>::new(),
};
assert_eq!(positions, []);
}
#[test]
fn test_fmindex_backward_search_optimization() {
let text = b"GATTACA$";
let pattern = &text[..text.len() - 1];
let alphabet = dna::n_alphabet();
let sa = suffix_array(text);
let bwt = bwt(text, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fm = FMIndex::new(&bwt, &less, &occ);
let sai = fm.backward_search(pattern.iter());
let positions = match sai {
BackwardSearchResult::Complete(saint) => saint.occ(&sa),
BackwardSearchResult::Partial(saint, _l) => saint.occ(&sa),
BackwardSearchResult::Absent => Vec::<usize>::new(),
};
assert_eq!(positions, [0]);
}
#[test]
fn test_fmindex_backward_search_partial_match() {
let text = b"GATTACA$";
let pattern = b"GTACA";
let alphabet = dna::n_alphabet();
let sa = suffix_array(text);
let bwt = bwt(text, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fm = FMIndex::new(&bwt, &less, &occ);
let sai = fm.backward_search(pattern.iter());
let mut partial_match_len = 0;
let positions = match sai {
BackwardSearchResult::Complete(saint) => saint.occ(&sa),
BackwardSearchResult::Partial(saint, l) => {
partial_match_len = l;
saint.occ(&sa)
}
BackwardSearchResult::Absent => Vec::<usize>::new(),
};
assert_eq!(partial_match_len, 4);
assert_eq!(positions, [3]);
}
#[test]
fn test_smems() {
let orig_text = b"GCCTTAACAT";
let revcomp_text = dna::revcomp(orig_text);
let text_builder: Vec<&[u8]> = vec![orig_text, b"$", &revcomp_text[..], b"$"];
let text = text_builder.concat();
let alphabet = dna::n_alphabet();
let sa = suffix_array(&text);
let bwt = bwt(&text, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fmindex = FMIndex::new(&bwt, &less, &occ);
let fmdindex = FMDIndex::from(fmindex);
{
let pattern = b"AA";
let intervals = fmdindex.smems(pattern, 0, 0);
let forward = intervals[0].0.forward();
let revcomp = intervals[0].0.revcomp();
let pattern_position = intervals[0].1;
let smem_len = intervals[0].2;
assert_eq!(forward.occ(&sa), [5, 16]);
assert_eq!(revcomp.occ(&sa), [3, 14]);
assert_eq!(pattern_position, 0);
assert_eq!(smem_len, 2);
}
{
let pattern = b"CTTAA";
let intervals = fmdindex.smems(pattern, 1, 0);
assert_eq!(intervals[0].0.forward().occ(&sa), [2]);
assert_eq!(intervals[0].0.revcomp().occ(&sa), [14]);
assert_eq!(intervals[0].1, 0);
assert_eq!(intervals[0].2, 5);
assert_eq!(intervals[0].0.match_size, 5);
}
{
let pattern = b"CTTAA";
let intervals = fmdindex.smems(pattern, 1, 7);
assert!(intervals.is_empty());
}
}
#[test]
fn test_all_smems() {
let text = b"ATTCGGGG$CCCCGAAT$";
let alphabet = dna::n_alphabet();
let sa = suffix_array(text);
let bwt = bwt(text, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fm = FMIndex::new(&bwt, &less, &occ);
let fmdindex = FMDIndex::from(fm);
{
let pattern = b"ATTGGGG";
let intervals = fmdindex.all_smems(pattern, 0);
assert_eq!(intervals.len(), 2);
let solutions = vec![[0, 14, 0, 3], [4, 9, 3, 4]];
for (i, interval) in intervals.iter().enumerate() {
let forward_positions = interval.0.forward().occ(&sa);
let revcomp_positions = interval.0.revcomp().occ(&sa);
let pattern_position = interval.1;
let smem_len = interval.2;
assert_eq!(
[
forward_positions[0],
revcomp_positions[0],
pattern_position,
smem_len
],
solutions[i]
);
}
}
}
#[test]
fn test_init_interval() {
let text = b"ACGT$TGCA$";
let alphabet = dna::n_alphabet();
let sa = suffix_array(text);
let bwt = bwt(text, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fmindex = FMIndex::new(&bwt, &less, &occ);
let fmdindex = FMDIndex::from(fmindex);
let pattern = b"T";
let interval = fmdindex.init_interval_with(pattern[0]);
assert_eq!(interval.forward().occ(&sa), [3, 5]);
assert_eq!(interval.revcomp().occ(&sa), [8, 0]);
let empty = fmdindex.init_interval();
let extended = fmdindex.backward_ext(&empty, pattern[0]);
assert_eq!(extended, interval);
let extended = fmdindex.forward_ext(&empty, pattern[0]);
assert_eq!(extended, interval);
}
#[test]
fn test_issue39() {
let reads = b"GGCGTGGTGGCTTATGCCTGTAATCCCAGCACTTTGGGAGGTCGAAGTGGGCGG$CCGC\
CCACTTCGACCTCCCAAAGTGCTGGGATTACAGGCATAAGCCACCACGCC$CGAAGTGG\
GCGGATCACTTGAGGTCAGGAGTTGGAGACTAGCCTGGCCAACACGATGAAACCCCGTC\
TCTAATA$TATTAGAGACGGGGTTTCATCGTGTTGGCCAGGCTAGTCTCCAACTCCTGA\
CCTCAAGTGATCCGCCCACTTCG$AGCTCGAAAAATGTTTGCTTATTTTGGTAAAATTA\
TTCATTGACTATGCTCAGAAATCAAGCAAACTGTCCATATTTCATTTTTTG$CAAAAAA\
TGAAATATGGACAGTTTGCTTGATTTCTGAGCATAGTCAATGAATAATTTTACCAAAAT\
AAGCAAACATTTTTCGAGCT$AGCTCGAAAAATGTTTGCTTATTTTGGTAAAATTATTC\
ATTGACTATGCTCAGAAATCAAGCAAACTGTCCATATTTCATTTTTTGAAATTACATAT\
$ATATGTAATTTCAAAAAATGAAATATGGACAGTTTGCTTGATTTCTGAGCATAGTCAA\
TGAATAATTTTACCAAAATAAGCAAACATTTTTCGAGCT$TAAAATTTCCTCTGACAGT\
GTAAAAGAGATCTTCATACAAAAATCAGAATTTATATAGTCTCTTTCCAAAAGACCATA\
AAACCAATCAGTTAATAGTTGAT$ATCAACTATTAACTGATTGGTTTTATGGTCTTTTG\
GAAAGAGACTATATAAATTCTGATTTTTGTATGAAGATCTCTTTTACACTGTCAGAGGA\
AATTTTA$CACCTATCTACCCTGAATCTAAGTGCTAACAGGAAAGGATGCCAGATTGCA\
TGCCTGCTGATAAAGCCACAGTTTGGACTGTCACTCAATCACCATCGTTC$GAACGATG\
GTGATTGAGTGACAGTCCAAACTGTGGCTTTATCAGCAGGCATGCAATCTGGCATCCTT\
TCCTGTTAGCACTTAGATTCAGGGTAGATAGGTG$CATCGTTCCTCCTGTGACTCAGTA\
TAACAAGATTGGGAGAATACTCTACAGTTCCTGATTCCCCCACAG$CTGTGGGGGAATC\
AGGAACTGTAGAGTATTCTCCCAATCTTGTTATACTGAGTCACAGGAGGAACGATG$TG\
TAAATTCTGAGAAAAATTTGCAGGTCTTTCTTCAGGAGCATGTAATCTCTTGCTCTCTT\
TGTTATCTATCTATAGTACTGTAGGTTATCTGGAGTTGCT$AGCAACTCCAGATAACCT\
ACAGTACTATAGATAGATAACAAAGAGAGCAAGAGATTACATGCTCCTGAAGAAAGACC\
TGCAAATTTTTCTCAGAATTTACA$CACTTCTCCTTGTCTTTACAGACTGGTTTTGCAC\
TGGGAAATCCTTTCACCAGTCAGCCCAGTTAGAGATTCTG$CAGAATCTCTAACTGGGC\
TGACTGGTGAAAGGATTTCCCAGTGCAAAACCAGTCTGTAAAGACAAGGAGAAGTG$AA\
TGGAGGTATATAAATTATCTGGCAAAGTGACATATCCTGACACATTCTCCAGGATAGAT\
CAAATGTTAGGTCACAAAGAGAGTCTTAACAAAATT$AATTTTGTTAAGACTCTCTTTG\
TGACCTAACATTTGATCTATCCTGGAGAATGTGTCAGGATATGTCACTTTGCCAGATAA\
TTTATATACCTCCATT$TTAATTTTGTTAAGACTCTCTTTGTGACCTAACATTTGATCT\
ATCCTGGAGAATGTGTCAGGATATGTCACTTTGCCAGATAATTTATATACCTCCATTTT\
$AAAATGGAGGTATATAAATTATCTGGCAAAGTGACATATCCTGACACATTCTCCAGGA\
TAGATCAAATGTTAGGTCACAAAGAGAGTCTTAACAAAATTAA$TTCTTCTTTGACTCA\
TTGGTTGTTCAATAGTATGTTGTTTAATTTCCATATATTTGTAAATGTTTCCGTTTTCC\
TTCTACTATTGAATTTTTGCTTCATC$GATGAAGCAAAAATTCAATAGTAGAAGGAAAA\
CGGAAACATTTACAAATATATGGAAATTAAACAACATACTATTGAACAACCAATGAGTC\
AAAGAAGAA$AGGAAAACGGAAACATTTACAAATATATGGAAATTAAACAACATACTAT\
TGAACAACCAATGAGTCAAAGAAGAAATCAAAAAGAATATTAGAAAAC$GTTTTCTAAT\
ATTCTTTTTGATTTCTTCTTTGACTCATTGGTTGTTCAATAGTATGTTGTTTAATTTCC\
ATATATTTGTAAATGTTTCCGTTTTCCT$TTAGAAAACAAGCTGACAAAAAAATAAAAA\
AACACAACATAGCAAAACTTAGAAATGCAGCAAAGGCAGTACTAAAGAGGGAAATTTAT\
AGCAATAAATGC$GCATTTATTGCTATAAATTTCCCTCTTTAGTACTGCCTTTGCTGCA\
TTTCTAAGTTTTGCTATGTTGTGTTTTTTTATTTTTTTGTCAGCTTGTTTTCTAA$TTT\
ATTGCTATAAATTTCCCTCTTTAGTACTGCCTTTGCTGCATTTCTAAGTTTTGCTATGT\
TGTGTTTTTTTATTTTTTTGTCAGCTTGTTTTCTA$TAGAAAACAAGCTGACAAAAAAA\
TAAAAAAACACAACATAGCAAAACTTAGAAATGCAGCAAAGGCAGTACTAAAGAGGGAA\
ATTTATAGCAATAAA$TCTTTCTTCTTTTTTAAGGTAGGCATTTATTGCTATAAATTTC\
CCTCTTTAGTACTGCCTTTG$CAAAGGCAGTACTAAAGAGGGAAATTTATAGCAATAAA\
TGCCTACCTTAAAAAAGAAGAAAGA$";
let alphabet = dna::n_alphabet();
let sa = suffix_array(reads);
let bwt = bwt(reads, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fmindex = FMIndex::new(&bwt, &less, &occ);
let fmdindex = FMDIndex::from(fmindex);
let read = b"GGCGTGGTGGCTTATGCCTGTAATCCCAGCACTTTGGGAGGTCGAAGTGGGCGG";
let read_pos = 0;
for i in 0..read.len() {
println!("i {}", i);
let intervals = fmdindex.smems(read, i, 0);
println!("{:?}", intervals);
let matches = intervals
.iter()
.flat_map(|interval| interval.0.forward().occ(&sa))
.collect::<Vec<usize>>();
assert_eq!(matches, vec![read_pos]);
}
}
}