logo
pub fn suffix_array(text: &[u8]) -> RawSuffixArray
Expand description

Construct suffix array for given text of length n. Complexity: O(n). This is an implementation of the induced sorting as presented by Ge Nong, Sen Zhang und Wai Hong Chan (2009), also known as SAIS. The implementation is based on the following lecture notes: http://ls11-www.cs.tu-dortmund.de/people/rahmann/algoseq.pdf

The idea is to first mark positions as L or S, with L being a position the suffix of which is lexicographically larger than that of the next position. Then, LMS-positions (leftmost S) are S-positions right to an L-position. An LMS substring is the substring from one LMS position to the next (inclusive). The algorithm works as follows:

  1. Sort LMS positions: first step 2 is applied to the unsorted sequence of positions. Surprisingly, this sorts the LMS substrings. If all substrings are different, LMS positions (and their suffixes) are sorted. Else, a reduced text is build (at most half the size of the original text) and we recurse into suffix array construction on the reduced text, yielding the sorted LMS positions.
  2. Derive the order of the other positions/suffixes from the (sorted) LMS positions. For this, the (still empty) suffix array is partitioned into buckets. Each bucket denotes an interval of suffixes with the same first symbol. We know that the L-suffixes have to occur first in the buckets, because they have to be lexicographically smaller than the S-suffixes with the same first letter. The LMS-positions can now be used to insert the L-positions in the correct order into the buckets. Then, the S-positions can be inserted, again using the already existing entries in the array.

Arguments

  • text - the text, ended by sentinel symbol (being lexicographically smallest). The text may also contain multiple sentinel symbols, used to concatenate multiple sequences without mixing their suffixes together.

Example

use bio::data_structures::suffix_array::suffix_array;
let text = b"GCCTTAACATTATTACGCCTA$";
let pos = suffix_array(text);
assert_eq!(
    pos,
    vec![21, 20, 5, 6, 14, 11, 8, 7, 17, 1, 15, 18, 2, 16, 0, 19, 4, 13, 10, 3, 12, 9]
);