[−][src]Crate bio
Rust-bio, a bioinformatics library for Rust.
This library provides implementations of many algorithms and data structures that are useful for bioinformatics. All provided implementations are rigorously tested via continuous integration.
For getting started with using rust-bio, see the Getting started section below.
For navigating the documentation of the available modules, see the Modules section below.
If you want to contribute to rust-bio, see the Contribute section in the repo.
Currently, rust-bio provides
- most major pattern matching algorithms,
- a convenient alphabet implementation,
- pairwise alignment,
- suffix arrays,
- the Burrows-Wheeler-transform (BWT)
- the Full-text index in Minute space index (FM-index),
- FMD-Index for finding supermaximal exact matches,
- a q-gram index,
- utilities to work with PSSMs,
- an open reading frame (ORF) search algorithm,
- a rank/select data structure,
- serde support for all data structures when built with
nightlyfeature, - readers and writers for FASTQ, FASTA and BED,
- helper functions for combinatorics and dealing with log probabilities,
- an implementation of the Hidden Markov Model and related algorithms.
For reading and writing SAM/BAM/CRAM, VCF/BCF files or tabix indexed files, have a look at rust-htslib.
Getting started
We explain how to use Rust-Bio step-by-step.
Users who already have experience with Rust can skip right to Step 3: Use Rust-Bio in your project.
Users who already know rust-bio might want to jump right into the modules docs
Step 1: Setting up Rust
Rust can be installed following the instruction for rustup.
Step 2: Setting up a new Rust project
Since Rust-Bio is a library, you need to setup your own new Rust project to use Rust-Bio. With Rust, projects and their dependencies are managed with the builtin package manager Cargo. To create a new Rust project, issue
cargo new hello_world --bin
cd hello_world
in your terminal. The flag --bin tells Cargo to create an executable project instead of a library.
In this section of the Rust docs, you find details about what Cargo just created for you.
Your new project can be compiled with
cargo build
If dependencies in your project are out of date, update with
cargo update
Execute the compiled code with
cargo run
If you are new to Rust, we suggest to proceed with learning Rust via the Rust docs.
Step 3: Use Rust-Bio in your project
To use Rust-Bio in your Rust project, add the following to your Cargo.toml
[dependencies]
bio = "*"
and import the crate from your source code:
extern crate bio;
Example: FM-index and FASTQ
An example of using rust-bio:
// Import some modules use bio::alphabets; use bio::data_structures::bwt::{bwt, less, Occ}; use bio::data_structures::fmindex::{FMIndex, FMIndexable}; use bio::data_structures::suffix_array::suffix_array; use bio::io::fastq; use bio::io::fastq::FastqRead; use std::io; // a given text let text = b"ACAGCTCGATCGGTA"; let pattern = b"ATCG"; // Create an FM-Index for the given text. // instantiate an alphabet let alphabet = alphabets::dna::iupac_alphabet(); // calculate a suffix array let sa = suffix_array(text); // calculate the Burrows-Wheeler-transform let bwt = bwt(text, &sa); // calculate the vectors less and Occ (occurrences) let less = less(&bwt, &alphabet); let occ = Occ::new(&bwt, 3, &alphabet); // set up FMIndex let fmindex = FMIndex::new(&bwt, &less, &occ); // do a backwards search for the pattern let interval = fmindex.backward_search(pattern.iter()); let positions = interval.occ(&sa); // Iterate over a FASTQ file, use the alphabet to validate read // sequences and search for exact matches in the FM-Index. // create FASTQ reader let mut reader = fastq::Reader::new(io::stdin()); let mut record = fastq::Record::new(); reader.read(&mut record).expect("Failed to parse record"); while !record.is_empty() { let check = record.check(); if check.is_err() { panic!("I got a rubbish record!") } // obtain sequence let seq = record.seq(); // check, whether seq is in the expected alphabet if alphabet.is_word(seq) { let interval = fmindex.backward_search(seq.iter()); let positions = interval.occ(&positions); } reader.read(&mut record).expect("Failed to parse record"); }
Documentation and further examples for each module can be found in the module descriptions below.
Example: Multithreaded
use bio::alphabets; use bio::data_structures::bwt::{bwt, less, Occ}; use bio::data_structures::fmindex::{FMIndex, FMIndexable}; use bio::data_structures::suffix_array::suffix_array; use std::sync::Arc; use std::thread; let text = b"ACGGATGCTGGATCGGATCGCGCTAGCTA$"; let patterns = vec![b"ACCG", b"TGCT"]; // Create an FM-Index for a given text. let alphabet = alphabets::dna::iupac_alphabet(); let sa = suffix_array(text); let bwt = Arc::new(bwt(text, &sa)); let less = Arc::new(less(bwt.as_ref(), &alphabet)); let occ = Arc::new(Occ::new(bwt.as_ref(), 3, &alphabet)); let fmindex = Arc::new(FMIndex::new(bwt, less, occ)); // Spawn threads to perform backward searches for each interval let interval_calculators = patterns .into_iter() .map(|pattern| { let fmindex = fmindex.clone(); thread::spawn(move || fmindex.backward_search(pattern.iter())) }) .collect::<Vec<_>>(); // Loop through the results, extracting the positions array for each pattern for interval_calculator in interval_calculators { let positions = interval_calculator.join().unwrap().occ(&sa); }
Documentation and further examples for each module can be found in the module descriptions below.
Benchmarks
Since Rust-Bio is based on a compiled language, similar performance to C/C++ based libraries can be expected. Indeed, we find the pattern matching algorithms of Rust-Bio to perform in the range of the C++ library Seqan:
| Algorithm | Rust-Bio | Seqan |
|---|---|---|
| BNDM | 77ms | 80ms |
| Horspool | 122ms | 125ms |
| BOM | 103ms | 107ms |
| Shift-And | 241ms | 545ms |
We measured 10000 iterations of searching pattern GCGCGTACACACCGCCCG in the sequence of the hg38 MT chromosome.
Initialization time of each algorithm for the given pattern was included in each iteration. Benchmarks were conducted with Cargo bench for Rust-Bio and Python timeit for Seqan on an Intel Core i5-3427U CPU.
Benchmarking Seqan from Python timeit entails an overhead of 1.46ms for calling a C++ binary. This overhead was subtracted from above Seqan run times.
Note that this benchmark only compares the two libraries to exemplify that Rust-Bio has comparable speed to C++ libraries: all used algorithms have their advantages for specific text and pattern structures and lengths (see the pattern matching section in the documentation)./!
Modules
| alignment | Various alignment and distance computing algorithms. |
| alphabets | Implementation of alphabets and useful utilities. |
| data_structures | Various useful data structures. |
| io | Readers and writers for common bioinformatics file formats. |
| pattern_matching | This module contains various useful pattern matching algorithms. The implementations are based on the lecture notes "Algorithmen auf Sequenzen", Kopczynski, Marschall, Martin and Rahmann, 2008 - 2015. |
| scores | |
| seq_analysis | Sequence analysis algorithms. |
| stats | Mathematical and statistical tools. |
| utils | Common utilities. |