1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834
// Copyright 2014-2016 Johannes Köster, Taylor Cramer.
// Licensed under the MIT license (http://opensource.org/licenses/MIT)
// This file may not be copied, modified, or distributed
// except according to those terms.
//! Suffix arrays and related algorithms.
//! The implementation is based on the lecture notes
//! "Algorithmen auf Sequenzen", Kopczynski, Marschall, Martin and Rahmann, 2008 - 2015.
use std;
use std::cmp;
use std::fmt::Debug;
use std::iter;
use std::ops::Deref;
use num_integer::Integer;
use num_traits::{cast, NumCast, Unsigned};
use bv::{BitVec, Bits, BitsMut};
use vec_map::VecMap;
use alphabets::{Alphabet, RankTransform};
use data_structures::smallints::SmallInts;
pub type LCPArray = SmallInts<i8, isize>;
pub type RawSuffixArray = Vec<usize>;
/// A trait exposing general functionality of suffix arrays.
pub trait SuffixArray {
fn get(&self, index: usize) -> Option<usize>;
fn len(&self) -> usize;
fn is_empty(&self) -> bool;
// /// Sample the suffix array with the given sample rate.
// ///
// /// # Arguments
// ///
// /// * `bwt` - the corresponding BWT
// /// * `less` - the corresponding less array
// /// * `occ` - the corresponding occ table
// /// * `sampling_rate` - if sampling rate is k, every k-th entry will be kept
// ///
// /// # Example
// ///
// /// ```
// /// use bio::data_structures::suffix_array::{suffix_array, SuffixArray};
// /// use bio::data_structures::bwt::{bwt, less, Occ};
// /// use bio::alphabets::dna;
// ///
// /// let text = b"ACGCGAT$";
// /// let alphabet = dna::n_alphabet();
// /// let sa = suffix_array(text);
// /// let bwt = bwt(text, &sa);
// /// let less = less(&bwt, &alphabet);
// /// let occ = Occ::new(&bwt, 3, &alphabet);
// /// let sampled = sa.sample(&bwt, &less, &occ, 1);
// ///
// /// for i in 0..sa.len() {
// /// assert_eq!(sa.get(i), sampled.get(i));
// /// }
// /// ```
// fn sample<DBWT: DerefBWT, DLess: DerefLess, DOcc: DerefOcc>
// (&self, bwt: DBWT, less: DLess, occ: DOcc, sampling_rate: usize) ->
// SampledSuffixArray<DBWT, DLess, DOcc> {
//
// let mut sample = Vec::with_capacity((self.len() as f32 / sampling_rate as f32).ceil() as usize);
// for i in 0..self.len() {
// if (i % sampling_rate) == 0 {
// sample.push(self.get(i).unwrap());
// }
// }
//
// SampledSuffixArray {
// bwt: bwt,
// less: less,
// occ: occ,
// sample: sample,
// s: sampling_rate,
// }
// }
}
// /// A sampled suffix array.
// pub struct SampledSuffixArray<DBWT: DerefBWT, DLess: DerefLess, DOcc: DerefOcc> {
// bwt: DBWT,
// less: DLess,
// occ: DOcc,
// sample: Vec<usize>,
// s: usize, // Rate of sampling
// }
impl SuffixArray for RawSuffixArray {
fn get(&self, index: usize) -> Option<usize> {
// Explicitly written out because Vec::get(index) generates a recursion warning
if index < self.len() {
Some(self[index])
} else {
None
}
}
fn len(&self) -> usize {
Vec::len(self)
}
fn is_empty(&self) -> bool {
Vec::is_empty(self)
}
// fn sample<DBWT: DerefBWT, DLess: DerefLess, DOcc: DerefOcc>
// (&self, bwt: DBWT, less: DLess, occ: DOcc, sampling_rate: usize) ->
// SampledSuffixArray<DBWT, DLess, DOcc> {
// // Provide a specialized, faster implementation using iterators.
//
// let sample = self.iter().cloned().step(sampling_rate).collect();
//
// SampledSuffixArray {
// bwt: bwt,
// less: less,
// occ: occ,
// sample: sample,
// s: sampling_rate,
// }
// }
}
// impl<DBWT: DerefBWT, DLess: DerefLess, DOcc: DerefOcc> SuffixArray for SampledSuffixArray<DBWT, DLess, DOcc> {
// fn get(&self, index: usize) -> Option<usize> {
// if index < self.len() {
// let mut pos = index;
// let mut offset = 0;
// loop {
// if pos % self.s == 0 {
// return Some(self.sample[pos / self.s] + offset);
// }
//
// let c = self.bwt[pos];
// pos = self.less[c as usize] + self.occ.get(&self.bwt, pos - 1, c);
// offset += 1;
// }
// } else {
// None
// }
// }
//
// fn len(&self) -> usize {
// self.bwt.len()
// }
// fn is_empty(&self) -> bool {
// self.bwt.is_empty()
// }
// }
//
//
// impl<DBWT: DerefBWT, DLess: DerefLess, DOcc: DerefOcc> SampledSuffixArray<DBWT, DLess, DOcc> {
// pub fn sampling_rate(&self) -> usize {
// self.s
// }
// }
/// Construct suffix array for given text of length n.
/// Complexity: O(n).
/// This is an implementation of the induced sorting as presented by
/// Ge Nong, Sen Zhang und Wai Hong Chan (2009), also known as SAIS.
/// The implementation is based on the following lecture notes:
/// http://ls11-www.cs.tu-dortmund.de/people/rahmann/algoseq.pdf
///
/// The idea is to first mark positions as L or S, with L being a position
/// the suffix of which is lexicographically larger than that of the next position.
/// Then, LMS-positions (leftmost S) are S-positions right to an L-position.
/// An LMS substring is the substring from one LMS position to the next (inclusive).
/// The algorithm works as follows:
///
/// 1. Sort LMS positions: first step 2 is applied to the unsorted sequence
/// of positions. Surprisingly, this sorts the LMS substrings. If all substrings
/// are different, LMS positions (and their suffixes) are sorted. Else, a reduced
/// text is build (at most half the size of the original text) and we recurse into
/// suffix array construction on the reduced text, yielding the sorted LMS positions.
/// 2. Derive the order of the other positions/suffixes from the (sorted) LMS positions.
/// For this, the (still empty) suffix array is partitioned into buckets.
/// Each bucket denotes an interval of suffixes with the same first symbol.
/// We know that the L-suffixes have to occur first in the buckets, because they
/// have to be lexicographically smaller than the S-suffixes with the same first letter.
/// The LMS-positions can now be used to insert the L-positions in the correct order
/// into the buckets.
/// Then, the S-positions can be inserted, again using the already existing entries
/// in the array.
///
/// # Arguments
///
/// * `text` - the text, ended by sentinel symbol (being lexicographically smallest). The text may
/// also contain multiple sentinel symbols, used to concatenate multiple sequences without mixing
/// their suffixes together.
///
/// # Example
///
/// ```
/// use bio::data_structures::suffix_array::suffix_array;
/// let text = b"GCCTTAACATTATTACGCCTA$";
/// let pos = suffix_array(text);
/// assert_eq!(pos, vec![
/// 21, 20, 5, 6, 14, 11, 8, 7, 17, 1, 15, 18,
/// 2, 16, 0, 19, 4, 13, 10, 3, 12, 9
/// ]);
/// ```
pub fn suffix_array(text: &[u8]) -> RawSuffixArray {
let n = text.len();
let alphabet = Alphabet::new(text);
let sentinel_count = sentinel_count(text);
let mut sais = SAIS::new(n);
match alphabet.len() + sentinel_count {
a if a <= std::u8::MAX as usize => {
sais.construct(&transform_text::<u8>(text, &alphabet, sentinel_count))
}
a if a <= std::u16::MAX as usize => {
sais.construct(&transform_text::<u16>(text, &alphabet, sentinel_count))
}
a if a <= std::u32::MAX as usize => {
sais.construct(&transform_text::<u32>(text, &alphabet, sentinel_count))
}
_ => sais.construct(&transform_text::<u64>(text, &alphabet, sentinel_count)),
}
sais.pos
}
/// Construct lcp array for given text and suffix array of length n.
/// Complexity: O(n).
///
/// # Arguments
///
/// * `text` - the text ended by sentinel symbol (being lexicographically smallest)
/// * `pos` - the suffix array for the text
///
/// # Example
///
/// ```
/// use bio::data_structures::suffix_array::{suffix_array,lcp};
/// let text = b"GCCTTAACATTATTACGCCTA$";
/// let pos = suffix_array(text);
///
/// // obtain compressed LCP array
/// let lcp = lcp(text, &pos);
///
/// // get most values in O(1).
/// assert_eq!(lcp.get(6).unwrap(), 4);
///
/// // obtain uncompressed LCP array.
/// let uncompressed = lcp.decompress();
/// assert_eq!(
/// uncompressed,
/// [
/// -1, 0, 1, 1, 2, 1, 4,
/// 0, 1, 3, 1, 1, 2, 0,
/// 4, 0, 2, 2, 2, 1, 3,
/// 3, -1
/// ]
/// )
/// ```
pub fn lcp<SA: Deref<Target = RawSuffixArray>>(text: &[u8], pos: SA) -> LCPArray {
assert_eq!(text.len(), pos.len());
let n = text.len();
// provide the lexicographical rank for each suffix
let mut rank: Vec<usize> = iter::repeat(0).take(n).collect();
for (r, p) in pos.iter().enumerate() {
rank[*p] = r;
}
let mut lcp = SmallInts::from_elem(-1, n + 1);
let mut l = 0usize;
for (p, &r) in rank.iter().enumerate().take(n - 1) {
// since the sentinel has rank 0 and is excluded above,
// we will never have a negative index below
let pred = pos[r - 1];
while pred + l < n && p + l < n && text[p + l] == text[pred + l] {
l += 1;
}
lcp.set(r, l as isize);
l = if l > 0 { l - 1 } else { 0 };
}
lcp
}
/// Calculate all locally shortest unique substrings from a given suffix and lcp array
/// (Ohlebusch (2013). "Bioinformatics Algorithms". ISBN 978-3-00-041316-2).
/// Complexity: O(n)
///
/// # Arguments
///
/// * `pos` - the suffix array
/// * `lcp` - the lcp array
///
/// # Returns
///
/// An vector of the length of the shortest unique substring for each position of the text.
/// Suffixes are excluded. If no unique substring starts at a given position, the entry is `None`.
///
/// # Example
///
/// ```
/// use bio::data_structures::suffix_array::{suffix_array,lcp,shortest_unique_substrings};
/// let text = b"GCTGCTA$";
/// let pos = suffix_array(text);
///
/// // obtain compressed LCP array
/// let lcp = lcp(text, &pos);
///
/// // calculate shortest unique substrings
/// let sus = shortest_unique_substrings(&pos, &lcp);
/// assert_eq!(sus, [Some(4), Some(3), Some(2), Some(4), Some(3), Some(2), Some(1), Some(1)]);
/// ```
pub fn shortest_unique_substrings<SA: SuffixArray>(pos: &SA, lcp: &LCPArray) -> Vec<Option<usize>> {
let n = pos.len();
// Initialize array representing the length of the shortest unique substring starting at position i
let mut sus = vec![None; n];
for i in 0..n {
// The longest common prefixes (LCP) of suffix pos[i] with its predecessor and successor are not unique.
// In turn the their maximum + 1 is the length of the shortest unique substring starting at pos[i].
let len = 1 + cmp::max(lcp.get(i).unwrap(), lcp.get(i + 1).unwrap_or(0)) as usize;
let p = pos.get(i).unwrap();
// Check if the suffix pos[i] is a prefix of pos[i+1]. In that case, there is no unique substring
// at this position.
if n - p >= len {
sus[p] = Some(len);
}
}
sus
}
/// Return last character of the text (expected to be the sentinel).
fn sentinel(text: &[u8]) -> u8 {
text[text.len() - 1]
}
/// Count the sentinels occurring in the text given that the last character is the sentinel.
fn sentinel_count(text: &[u8]) -> usize {
let sentinel = sentinel(text);
assert!(
text.iter().all(|&a| a >= sentinel),
"Expecting extra sentinel symbol being lexicographically smallest at the end of the \
text."
);
text.iter()
.fold(0, |count, &a| count + (a == sentinel) as usize)
}
/// Transform the given text into integers for usage in `SAIS`.
fn transform_text<T: Integer + Unsigned + NumCast + Copy + Debug>(
text: &[u8],
alphabet: &Alphabet,
sentinel_count: usize,
) -> Vec<T> {
let sentinel = sentinel(text);
let transform = RankTransform::new(alphabet);
let offset = sentinel_count - 1;
let mut transformed: Vec<T> = Vec::with_capacity(text.len());
let mut s = sentinel_count;
for &a in text.iter() {
if a == sentinel {
s -= 1;
transformed.push(cast(s).unwrap());
} else {
transformed
.push(cast(*(transform.ranks.get(a as usize)).unwrap() as usize + offset).unwrap());
}
}
transformed
}
/// SAIS implementation (see function `suffix_array` for description).
struct SAIS {
pos: Vec<usize>,
lms_pos: Vec<usize>,
reduced_text_pos: Vec<usize>,
bucket_sizes: VecMap<usize>,
bucket_start: Vec<usize>,
bucket_end: Vec<usize>,
}
impl SAIS {
/// Create a new instance.
fn new(n: usize) -> Self {
SAIS {
pos: Vec::with_capacity(n),
lms_pos: Vec::with_capacity(n),
reduced_text_pos: vec![0; n],
bucket_sizes: VecMap::new(),
bucket_start: Vec::with_capacity(n),
bucket_end: Vec::with_capacity(n),
}
}
/// Init buckets.
fn init_bucket_start<T: Integer + Unsigned + NumCast + Copy>(&mut self, text: &[T]) {
self.bucket_sizes.clear();
self.bucket_start.clear();
for &c in text.iter() {
if !self.bucket_sizes.contains_key(cast(c).unwrap()) {
self.bucket_sizes.insert(cast(c).unwrap(), 0);
}
*(self.bucket_sizes.get_mut(cast(c).unwrap()).unwrap()) += 1;
}
let mut sum = 0;
for &size in self.bucket_sizes.values() {
self.bucket_start.push(sum);
sum += size;
}
}
/// Initialize pointers to the last element of the buckets.
fn init_bucket_end<T: Integer + Unsigned + NumCast + Copy>(&mut self, text: &[T]) {
self.bucket_end.clear();
for &r in self.bucket_start[1..].iter() {
self.bucket_end.push(r - 1);
}
self.bucket_end.push(text.len() - 1);
}
/// Check if two LMS substrings are equal.
fn lms_substring_eq<T: Integer + Unsigned + NumCast + Copy>(
&self,
text: &[T],
pos_types: &PosTypes,
i: usize,
j: usize,
) -> bool {
for k in 0.. {
let lmsi = pos_types.is_lms_pos(i + k);
let lmsj = pos_types.is_lms_pos(j + k);
if text[i + k] != text[j + k] {
// different symbols
return false;
}
if lmsi != lmsj {
// different length
return false;
}
if k > 0 && lmsi && lmsj {
// same symbols and same length
return true;
}
}
false
}
/// Sort LMS suffixes.
fn sort_lms_suffixes<
T: Integer + Unsigned + NumCast + Copy + Debug,
S: Integer + Unsigned + NumCast + Copy + Debug,
>(
&mut self,
text: &[T],
pos_types: &PosTypes,
lms_substring_count: usize,
) {
// if less than 2 LMS substrings are present, no further sorting is needed
if lms_substring_count > 1 {
// sort LMS suffixes by recursively building SA on reduced text
let mut reduced_text: Vec<S> = vec![cast(0).unwrap(); lms_substring_count];
let mut label = 0;
reduced_text[self.reduced_text_pos[self.pos[0]]] = cast(label).unwrap();
let mut prev = None;
for &p in &self.pos {
if pos_types.is_lms_pos(p) {
// choose same label if substrings are equal
if prev.is_some() && !self.lms_substring_eq(text, pos_types, prev.unwrap(), p) {
label += 1;
}
reduced_text[self.reduced_text_pos[p]] = cast(label).unwrap();
prev = Some(p);
}
}
// if we have less labels than substrings, we have to sort by recursion
// because two or more substrings are equal
if label + 1 < lms_substring_count {
// backup lms_pos
let lms_pos = self.lms_pos.clone();
// recurse SA construction for reduced text
self.construct(&reduced_text);
// obtain sorted lms suffixes
self.lms_pos.clear();
for &p in &self.pos {
self.lms_pos.push(lms_pos[p]);
}
} else {
// otherwise, lms_pos is updated with the sorted suffixes from pos
// obtain sorted lms suffixes
self.lms_pos.clear();
for &p in &self.pos {
if pos_types.is_lms_pos(p) {
self.lms_pos.push(p);
}
}
}
}
}
/// Construct the suffix array.
fn construct<T: Integer + Unsigned + NumCast + Copy + Debug>(&mut self, text: &[T]) {
let pos_types = PosTypes::new(text);
self.calc_lms_pos(text, &pos_types);
self.calc_pos(text, &pos_types);
}
/// Step 1 of the SAIS algorithm.
fn calc_lms_pos<T: Integer + Unsigned + NumCast + Copy + Debug>(
&mut self,
text: &[T],
pos_types: &PosTypes,
) {
let n = text.len();
// collect LMS positions
self.lms_pos.clear();
let mut i = 0;
for r in 0..n {
if pos_types.is_lms_pos(r) {
self.lms_pos.push(r);
self.reduced_text_pos[r] = i;
i += 1;
}
}
// sort LMS substrings by applying step 2 with unsorted LMS positions
self.calc_pos(text, pos_types);
let lms_substring_count = self.lms_pos.len();
if lms_substring_count <= std::u8::MAX as usize {
self.sort_lms_suffixes::<T, u8>(text, pos_types, lms_substring_count);
} else if lms_substring_count <= std::u16::MAX as usize {
self.sort_lms_suffixes::<T, u16>(text, pos_types, lms_substring_count);
} else if lms_substring_count <= std::u32::MAX as usize {
self.sort_lms_suffixes::<T, u32>(text, pos_types, lms_substring_count);
} else {
self.sort_lms_suffixes::<T, u64>(text, pos_types, lms_substring_count);
}
}
/// Step 2 of the SAIS algorithm.
fn calc_pos<T: Integer + Unsigned + NumCast + Copy>(
&mut self,
text: &[T],
pos_types: &PosTypes,
) {
let n = text.len();
self.pos.clear();
self.init_bucket_start(text);
self.init_bucket_end(text);
// init all positions as unknown (n-1 is max position)
for _ in text.iter() {
self.pos.push(n);
}
// insert LMS positions to the end of their buckets
for &p in self.lms_pos.iter().rev() {
let c: usize = cast(text[p]).unwrap();
self.pos[self.bucket_end[c]] = p;
// subtract without overflow: last -1 will cause overflow, but it does not matter
self.bucket_end[c] = self.bucket_end[c].wrapping_sub(1);
}
// reset bucket ends
self.init_bucket_end(text);
// insert L-positions into buckets
for r in 0..n {
let p = self.pos[r];
// ignore undefined positions and the zero since it has no predecessor
if p == n || p == 0 {
continue;
}
let pred = p - 1;
if pos_types.is_l_pos(pred) {
let c: usize = cast(text[pred]).unwrap();
self.pos[self.bucket_start[c]] = pred;
self.bucket_start[c] += 1;
}
}
// insert S-positions into buckets
for r in (0..n).rev() {
let p = self.pos[r];
if p == 0 {
continue;
}
let pred = p - 1;
if pos_types.is_s_pos(pred) {
let c: usize = cast(text[pred]).unwrap();
self.pos[self.bucket_end[c]] = pred;
// subtract without overflow: last -1 will cause overflow, but it won't be used
self.bucket_end[c] = self.bucket_end[c].wrapping_sub(1);
}
}
}
}
/// Position types (L or S).
#[derive(Debug)]
struct PosTypes {
pos_types: BitVec,
}
impl PosTypes {
/// Calculate the text position type.
/// L-type marks suffixes being lexicographically larger than their successor,
/// S-type marks the others.
/// This function fills a BitVec, with 1-bits denoting S-type
/// and 0-bits denoting L-type.
///
/// # Arguments
///
/// * `text` - the text, ending with a sentinel.
fn new<T: Integer + Unsigned + NumCast + Copy>(text: &[T]) -> Self {
let n = text.len();
let mut pos_types = BitVec::new_fill(false, n as u64);
pos_types.set_bit(n as u64 - 1, true);
for p in (0..n - 1).rev() {
if text[p] == text[p + 1] {
// if the characters are equal, the next position determines
// the lexicographical order
let v = pos_types.get_bit(p as u64 + 1);
pos_types.set_bit(p as u64, v);
} else {
pos_types.set_bit(p as u64, text[p] < text[p + 1]);
}
}
PosTypes { pos_types }
}
/// Check if p is S-position.
fn is_s_pos(&self, p: usize) -> bool {
self.pos_types.get_bit(p as u64)
}
/// Check if p is L-position.
fn is_l_pos(&self, p: usize) -> bool {
!self.pos_types.get_bit(p as u64)
}
/// Check if p is LMS-position.
fn is_lms_pos(&self, p: usize) -> bool {
p != 0 && self.is_s_pos(p) && self.is_l_pos(p - 1)
}
}
#[cfg(test)]
mod tests {
// Commented-out imports waiting on re-enabling of sampled suffix array
// See issue #70
use super::*;
use super::{transform_text, PosTypes, SAIS};
use alphabets::Alphabet;
use bv::{BitVec, BitsPush};
//use data_structures::bwt::{bwt, less, Occ};
use std::str;
#[test]
fn test_pos_types() {
let orig_text = b"GCCTTAACATTATTACGCCTA$";
let alphabet = Alphabet::new(orig_text);
let text: Vec<u8> = transform_text(orig_text, &alphabet, 1);
let n = text.len();
let pos_types = PosTypes::new(&text);
//let mut test = BitSlice::from_slice(&[0b01100110, 0b10010011, 0b01100100]).to_owned();
let mut test = BitVec::new();
test.push_block(0b001001101100100101100110);
test.truncate(n as u64);
assert_eq!(pos_types.pos_types, test);
let lms_pos: Vec<usize> = (0..n).filter(|&p| pos_types.is_lms_pos(p)).collect();
assert_eq!(lms_pos, vec![1, 5, 8, 11, 14, 17, 21]);
}
#[test]
fn test_buckets() {
let orig_text = b"GCCTTAACATTATTACGCCTA$";
let alphabet = Alphabet::new(orig_text);
let text: Vec<u8> = transform_text(orig_text, &alphabet, 1);
let n = text.len();
let mut sais = SAIS::new(n);
sais.init_bucket_start(&text);
assert_eq!(sais.bucket_start, vec![0, 1, 7, 13, 15]);
sais.init_bucket_end(&text);
assert_eq!(sais.bucket_end, vec![0, 6, 12, 14, 21]);
}
#[test]
fn test_pos() {
let orig_text = b"GCCTTAACATTATTACGCCTA$";
let alphabet = Alphabet::new(orig_text);
let text: Vec<u8> = transform_text(orig_text, &alphabet, 1);
let n = text.len();
let mut sais = SAIS::new(n);
let pos_types = PosTypes::new(&text);
sais.lms_pos = vec![21, 5, 14, 8, 11, 17, 1];
sais.calc_pos(&text, &pos_types);
assert_eq!(
sais.pos,
vec![21, 20, 5, 6, 14, 11, 8, 7, 17, 1, 15, 18, 2, 16, 0, 19, 4, 13, 10, 3, 12, 9,]
);
}
#[test]
fn test_lms_pos() {
let orig_text = b"GCCTTAACATTATTACGCCTA$";
let alphabet = Alphabet::new(orig_text);
let text: Vec<u8> = transform_text(orig_text, &alphabet, 1);
let n = text.len();
let mut sais = SAIS::new(n);
let pos_types = PosTypes::new(&text);
sais.calc_lms_pos(&text, &pos_types);
}
#[test]
fn test_issue10_1() {
let text = b"TGTGTGTGTG$";
let pos = suffix_array(text);
assert_eq!(pos, [10, 9, 7, 5, 3, 1, 8, 6, 4, 2, 0]);
}
#[test]
fn test_issue10_2() {
let text = b"TGTGTGTG$";
let pos = suffix_array(text);
assert_eq!(pos, [8, 7, 5, 3, 1, 6, 4, 2, 0]);
}
#[test]
fn test_handles_sentinels_properly() {
let reads = b"TACTCCGCTAGGGACACCTAAATAGATACTCGCAAAGGCGACTGATATATCCTTAGGTCGAAGAGATACCAGAGAAATAGTAGGTCTTAGGCTAGTCCTT$AAGGACTAGCCTAAGACCTACTATTTCTCTGGTATCTCTTCGACCTAAGGATATATCAGTCGCCTTTGCGAGTATCTATTTAGGTGTCCCTAGCGGAGTA$TAGGGACACCTAAATAGATACTCGCAAAGGCGACTGATATATCCTTAGGTCGAAGAGATACCAGAGAAATAGTAGGTCTTAGGCTAGTCCTTGTCCAGTA$TACTGGACAAGGACTAGCCTAAGACCTACTATTTCTCTGGTATCTCTTCGACCTAAGGATATATCAGTCGCCTTTGCGAGTATCTATTTAGGTGTCCCTA$ACGCACCCCGGCATTCGTCGACTCTACACTTAGTGGAACATACAAATTCGCTCGCAGGAGCGCCTCATACATTCTAACGCAGTGATCTTCGGCTGAGACT$AGTCTCAGCCGAAGATCACTGCGTTAGAATGTATGAGGCGCTCCTGCGAGCGAATTTGTATGTTCCACTAAGTGTAGAGTCGACGAATGCCGGGGTGCGT$";
suffix_array(reads);
}
fn str_from_pos(sa: &Vec<usize>, text: &[u8], index: usize) -> String {
String::from(
str::from_utf8(&text[sa[index]..])
.unwrap()
.split("$")
.next()
.unwrap_or(""),
) + "$"
}
#[test]
fn test_sorts_lexically() {
let test_cases = [(&b"A$C$G$T$"[..], "simple"),
(&b"A$A$T$T$"[..], "duplicates"),
(&b"AA$GA$CA$TA$TC$TG$GT$GC$"[..], "two letter"),
(&b"AGCCAT$\
CAGCC$"[..],
"substring"),
(&b"GTAGGCCTAATTATAATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAA$\
AATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAATGGCTATTCCAATA$"[..],
"complex"),
(&b"GTAGGCCTAATTATAATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAA$\
TTCGACGCTGACCTCTTGAGGTTCCATTACCCGGCTACTGATGCTAAAATCCTGGCAGCCCGAGCAATACGAAATGTCCGCTGATTATAATTAGGCCTAC$\
AATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAATGGCTATTCCAATA$\
TATTGGAATAGCCATTCGACGCTGACCTCTTGAGGTTCCATTACCCGGCTACTGATGCTAAAATCCTGGCAGCCCGAGCAATACGAAATGTCCGCTGATT$"[..],
"complex with revcomps"),
];
for &(text, test_name) in test_cases.into_iter() {
let pos = suffix_array(text);
for i in 0..(pos.len() - 2) {
// Check that every element in the suffix array is lexically <= the next elem
let cur = str_from_pos(&pos, &text, i);
let next = str_from_pos(&pos, &text, i + 1);
assert!(
cur <= next,
format!(
"Failed:\n{}\n{}\nat positions {} and {} are out of order in \
test: {}",
cur,
next,
pos[i],
pos[i + 1],
test_name
)
);
}
}
}
// #[test]
// fn test_sampled_matches() {
// let test_cases = [(&b"A$C$G$T$"[..], "simple"),
// (&b"A$A$T$T$"[..], "duplicates"),
// (&b"AA$GA$CA$TA$TC$TG$GT$GC$"[..], "two letter"),
// (&b"AGCCAT$\
// CAGCC$"[..],
// "substring"),
// (&b"GTAGGCCTAATTATAATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAA$\
// AATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAATGGCTATTCCAATA$"[..],
// "complex"),
// (&b"GTAGGCCTAATTATAATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAA$\
// TTCGACGCTGACCTCTTGAGGTTCCATTACCCGGCTACTGATGCTAAAATCCTGGCAGCCCGAGCAATACGAAATGTCCGCTGATTATAATTAGGCCTAC$\
// AATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAATGGCTATTCCAATA$\
// TATTGGAATAGCCATTCGACGCTGACCTCTTGAGGTTCCATTACCCGGCTACTGATGCTAAAATCCTGGCAGCCCGAGCAATACGAAATGTCCGCTGATT$"[..],
// "complex with revcomps"),
// ];
//
// for &(text, _) in test_cases.into_iter() {
// let alphabet = dna::n_alphabet();
// let sa = suffix_array(text);
// let bwt = bwt(text, &sa);
// let less = less(&bwt, &alphabet);
// let occ = Occ::new(&bwt, 3, &alphabet);
// let sampled = sa.sample(&bwt, &less, &occ, 2);
//
// for i in 0..sa.len() {
// assert_eq!(sa.get(i), sampled.get(i));
// }
// }
// }
}