Module bio::data_structures::fmindex
[−]
[src]
FM-Index and FMD-Index for finding suffix array intervals matching a given pattern in linear time.
Examples
Generate
use bio::data_structures::bwt::{bwt, less, Occ}; use bio::data_structures::fmindex::{FMIndex, FMIndexable}; use bio::data_structures::suffix_array::suffix_array; use bio::alphabets::dna; let text = b"GCCTTAACATTATTACGCCTA$"; let alphabet = dna::n_alphabet(); let sa = suffix_array(text); let bwt = bwt(text, &sa); let less = less(&bwt, &alphabet); let occ = Occ::new(&bwt, 3, &alphabet); let fm = FMIndex::new(&bwt, &less, &occ);
Enclose in struct
FMIndex
was designed to not forcibly own the BWT and auxiliary data structures.
It can take a reference (&
) or any of the more complex pointer types.
This means that you need to use Rc
(a reference counted pointer) if you want to
put the FMIndex
into a struct.
use std::rc::Rc; use bio::data_structures::bwt::{BWT, Less, bwt, less, Occ}; use bio::data_structures::fmindex::{FMIndex, FMIndexable}; use bio::data_structures::suffix_array::suffix_array; use bio::alphabets::dna; use bio::utils::TextSlice; pub struct Example { fmindex: FMIndex<Rc<BWT>, Rc<Less>, Rc<Occ>> } impl Example { pub fn new(text: TextSlice) -> Self { let alphabet = dna::n_alphabet(); let sa = suffix_array(text); let bwt = bwt(text, &sa); let less = less(&bwt, &alphabet); let occ = Occ::new(&bwt, 3, &alphabet); let fm = FMIndex::new(Rc::new(bwt), Rc::new(less), Rc::new(occ)); Example { fmindex: fm } } }
Structs
BiInterval |
A bi-interval on suffix array of the forward and reverse strand of a DNA text. |
FMDIndex |
The FMD-Index for linear time search of supermaximal exact matches on forward and reverse strand of DNA texts (Li, 2012). |
FMIndex |
The Fast Index in Minute space (FM-Index, Ferragina and Manzini, 2000) for finding suffix array intervals matching a given pattern. |
Interval |
A suffix array interval. |
Traits
FMIndexable |