Module bio_seq::seq

Arbitrary length sequences of bit-packed genomic data, stored on the heap.

Seq and SeqSlice are analogous to String and str. A Seq owns its data and a SeqSlice is a read-only window into a Seq.

use std::collections::HashMap;
use bio_seq::prelude::*;

let reference: Seq<Dna> = dna!("ACGTTCGCATGCTACGACGATC");

let mut table: HashMap<Seq<Dna>, &SeqSlice<Dna>> = HashMap::new();
table.insert(dna!("ACGTT"), &reference[2..5]);
table.insert(dna!("ACACCCCC"), &reference[6..]);

// The query is a short window in the reference `Seq`
let query: &SeqSlice<Dna> = &reference[..5];

// The keys of the hashmap are `Seq`, but since `Seq` can be borrowed as a SeqSlice we can call `HashMap::get` on another slice.
if let Some(value) = table.get(query) {
       // `SeqSlice` implements `Display`
       println!("{value}");
}

Modules

• index
• iterators

Structs

• Seq
  A sequence of bit-packed characters of arbitrary length
• SeqSlice
  A lightweight, read-only window into part of a sequence

Traits

• ReverseComplement
  A reversible sequence of things that can be complemented can be reverse complemented